Incidental Mutation 'R6963:Mcoln2'
List |< first << previous [record 22 of 38] next >> last >|
ID543317
Institutional Source Beutler Lab
Gene Symbol Mcoln2
Ensembl Gene ENSMUSG00000011008
Gene Namemucolipin 2
Synonymsmucolipidin 2, TRPML2, 3300002C04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R6963 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146149833-146195513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146172035 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 137 (K137R)
Ref Sequence ENSEMBL: ENSMUSP00000096125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011152] [ENSMUST00000098524]
Predicted Effect probably damaging
Transcript: ENSMUST00000011152
AA Change: K165R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011152
Gene: ENSMUSG00000011008
AA Change: K165R

DomainStartEndE-ValueType
transmembrane domain 292 314 N/A INTRINSIC
transmembrane domain 340 362 N/A INTRINSIC
Pfam:PKD_channel 370 513 5.8e-12 PFAM
low complexity region 546 558 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098524
AA Change: K137R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096125
Gene: ENSMUSG00000011008
AA Change: K137R

DomainStartEndE-ValueType
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 312 334 N/A INTRINSIC
Pfam:PKD_channel 343 485 6.9e-11 PFAM
low complexity region 518 530 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mucolipins constitute a family of cation channel proteins with homology to the transient receptor potential superfamily. In mammals, the mucolipin family includes 3 members, MCOLN1 (MIM 605248), MCOLN2, and MCOLN3 (MIM 607400), that exhibit a common 6-membrane-spanning topology. Homologs of mammalian mucolipins exist in Drosophila and C. elegans. Mutations in the human MCOLN1 gene cause mucolipodosis IV (MIM 262650) (Karacsonyi et al., 2007 [PubMed 17662026]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced chemokine production in bone marrow-derived macrophages and impaired recruitment of peripheral macrophages in response to i.p. injections of LPS or live bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Mpp6 T C 6: 50,163,655 probably null Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Myo15b G T 11: 115,890,714 probably null Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rfc5 T A 5: 117,387,866 probably null Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
Skp2 T C 15: 9,139,428 probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Mcoln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Mcoln2 APN 3 146163527 splice site probably benign
IGL01370:Mcoln2 APN 3 146181830 missense possibly damaging 0.71
IGL01479:Mcoln2 APN 3 146175652 splice site probably benign
IGL02629:Mcoln2 APN 3 146170044 missense probably benign 0.28
R0010:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0010:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0039:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0039:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0044:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0044:Mcoln2 UTSW 3 146183561 missense probably damaging 0.99
R0109:Mcoln2 UTSW 3 146175718 missense probably damaging 1.00
R0458:Mcoln2 UTSW 3 146150013 unclassified probably benign
R1335:Mcoln2 UTSW 3 146180174 missense probably benign 0.00
R1440:Mcoln2 UTSW 3 146190382 nonsense probably null
R1452:Mcoln2 UTSW 3 146181814 missense possibly damaging 0.92
R1459:Mcoln2 UTSW 3 146192224 splice site probably null
R1510:Mcoln2 UTSW 3 146176610 missense probably benign 0.02
R1603:Mcoln2 UTSW 3 146180222 missense probably damaging 1.00
R1652:Mcoln2 UTSW 3 146163635 missense possibly damaging 0.48
R1718:Mcoln2 UTSW 3 146190474 splice site probably benign
R1826:Mcoln2 UTSW 3 146175472 missense possibly damaging 0.69
R4319:Mcoln2 UTSW 3 146150011 splice site probably null
R4719:Mcoln2 UTSW 3 146175713 missense probably benign 0.00
R4939:Mcoln2 UTSW 3 146192241 missense probably benign 0.07
R5475:Mcoln2 UTSW 3 146183786 missense probably damaging 1.00
R5718:Mcoln2 UTSW 3 146181826 missense probably damaging 1.00
R5906:Mcoln2 UTSW 3 146183741 missense probably damaging 1.00
R6911:Mcoln2 UTSW 3 146192256 missense probably damaging 1.00
R7142:Mcoln2 UTSW 3 146183569 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCGCATTCCGTATGGTAGG -3'
(R):5'- CAGGTATGGTCACAACAGCG -3'

Sequencing Primer
(F):5'- GATTTGTGGCTTTTGAGAACCCC -3'
(R):5'- TGGTTTCCTGAGCCAAGGC -3'
Posted On2018-11-28