Incidental Mutation 'R6963:Adgrb2'
List |< first << previous [record 54 of 1259] next >> last >|
ID543319
Institutional Source Beutler Lab
Gene Symbol Adgrb2
Ensembl Gene ENSMUSG00000028782
Gene Nameadhesion G protein-coupled receptor B2
SynonymsBai2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6963 (G1)
Quality Score217.468
Status Not validated
Chromosome4
Chromosomal Location129984870-130022633 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CG to C at 130014362 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030571] [ENSMUST00000097868] [ENSMUST00000106015] [ENSMUST00000106017] [ENSMUST00000106018] [ENSMUST00000120204] [ENSMUST00000121049]
Predicted Effect probably null
Transcript: ENSMUST00000030571
SMART Domains Protein: ENSMUSP00000030571
Gene: ENSMUSG00000028782

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:GAIN 600 842 1.6e-41 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 1.7e-67 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097868
SMART Domains Protein: ENSMUSP00000095480
Gene: ENSMUSG00000028782

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 1.2e-54 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1159 2.6e-69 PFAM
low complexity region 1324 1338 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106015
SMART Domains Protein: ENSMUSP00000101636
Gene: ENSMUSG00000028782

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.4e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 4.1e-68 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106017
SMART Domains Protein: ENSMUSP00000101638
Gene: ENSMUSG00000028782

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.3e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1180 4.6e-68 PFAM
low complexity region 1345 1359 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106018
SMART Domains Protein: ENSMUSP00000101639
Gene: ENSMUSG00000028782

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 1.1e-54 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 2.4e-69 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120204
SMART Domains Protein: ENSMUSP00000112524
Gene: ENSMUSG00000028782

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 8.2e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 9.6e-70 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121049
SMART Domains Protein: ENSMUSP00000112869
Gene: ENSMUSG00000028782

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 6.1e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1137 3.8e-68 PFAM
low complexity region 1302 1316 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a a seven-span transmembrane protein that is thought to be a member of the secretin receptor family. The encoded protein is a brain-specific inhibitor of angiogenesis. The mature peptide may be further cleaved into additional products (PMID:20367554). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene show a lessening of depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Adgrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Adgrb2 APN 4 130018805 missense probably damaging 1.00
IGL00425:Adgrb2 APN 4 130019072 missense probably benign 0.09
IGL00490:Adgrb2 APN 4 130011872 missense possibly damaging 0.82
IGL00928:Adgrb2 APN 4 129992303 missense probably benign
IGL01353:Adgrb2 APN 4 130012300 missense probably damaging 1.00
IGL01521:Adgrb2 APN 4 129992292 missense probably damaging 0.98
IGL01590:Adgrb2 APN 4 130013813 splice site probably benign
IGL01813:Adgrb2 APN 4 130012566 missense probably benign 0.00
IGL01831:Adgrb2 APN 4 130009394 missense probably damaging 1.00
IGL01939:Adgrb2 APN 4 129992132 missense probably damaging 0.99
IGL01960:Adgrb2 APN 4 130012384 splice site probably benign
IGL01993:Adgrb2 APN 4 130018842 missense possibly damaging 0.94
IGL02646:Adgrb2 APN 4 130019282 critical splice donor site probably null
IGL02655:Adgrb2 APN 4 129992179 nonsense probably null
IGL02695:Adgrb2 APN 4 130018832 missense probably damaging 1.00
IGL02998:Adgrb2 APN 4 130019069 missense probably benign 0.15
IGL03372:Adgrb2 APN 4 130017569 missense probably benign 0.42
R0098:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0206:Adgrb2 UTSW 4 129992559 missense probably damaging 1.00
R0311:Adgrb2 UTSW 4 130017129 missense probably damaging 1.00
R0380:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0382:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0492:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0544:Adgrb2 UTSW 4 130017542 missense probably damaging 0.98
R0965:Adgrb2 UTSW 4 129992416 small deletion probably benign
R1458:Adgrb2 UTSW 4 130014591 missense possibly damaging 0.48
R1601:Adgrb2 UTSW 4 129992837 missense probably benign 0.43
R1711:Adgrb2 UTSW 4 129992624 missense probably damaging 1.00
R1758:Adgrb2 UTSW 4 130011875 missense probably damaging 1.00
R1783:Adgrb2 UTSW 4 130009305 missense possibly damaging 0.61
R1827:Adgrb2 UTSW 4 130012557 missense probably damaging 1.00
R1838:Adgrb2 UTSW 4 130010231 missense probably benign 0.00
R1881:Adgrb2 UTSW 4 130010285 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1894:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R2275:Adgrb2 UTSW 4 130006854 missense probably damaging 1.00
R2926:Adgrb2 UTSW 4 130008344 missense probably damaging 1.00
R4472:Adgrb2 UTSW 4 130008353 missense probably benign 0.12
R4490:Adgrb2 UTSW 4 130012328 missense possibly damaging 0.91
R4499:Adgrb2 UTSW 4 129992661 missense probably damaging 0.99
R4758:Adgrb2 UTSW 4 130009350 missense probably damaging 1.00
R4900:Adgrb2 UTSW 4 130013875 missense probably damaging 1.00
R4904:Adgrb2 UTSW 4 130012539 missense possibly damaging 0.50
R4922:Adgrb2 UTSW 4 130007852 missense probably damaging 1.00
R5330:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5331:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5550:Adgrb2 UTSW 4 130014934 critical splice acceptor site probably null
R5995:Adgrb2 UTSW 4 130017103 missense probably damaging 1.00
R6047:Adgrb2 UTSW 4 130018705 missense probably damaging 1.00
R6534:Adgrb2 UTSW 4 130022219 missense probably damaging 0.98
R6565:Adgrb2 UTSW 4 130019276 missense probably damaging 1.00
R6813:Adgrb2 UTSW 4 130009491 missense probably damaging 1.00
R6966:Adgrb2 UTSW 4 130014362 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGTGGGAGAGGAAACAGACTTATC -3'
(R):5'- GATGAGCATGTTCACCTGGG -3'

Sequencing Primer
(F):5'- CAGACTTATCAAGACATGGCTGTGTC -3'
(R):5'- ATGTTCACCTGGGGGCCC -3'
Posted On2018-11-28