Incidental Mutation 'R6963:Ccdc149'
List |< first << previous [record 8 of 38] next >> last >|
ID543321
Institutional Source Beutler Lab
Gene Symbol Ccdc149
Ensembl Gene ENSMUSG00000045790
Gene Namecoiled-coil domain containing 149
SynonymsGm447, LOC242997
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6963 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location52374651-52471521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52439097 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 58 (R58W)
Ref Sequence ENSEMBL: ENSMUSP00000143041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059428] [ENSMUST00000198008]
Predicted Effect probably damaging
Transcript: ENSMUST00000059428
AA Change: R58W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062411
Gene: ENSMUSG00000045790
AA Change: R58W

DomainStartEndE-ValueType
Pfam:DUF2353 21 333 3.5e-117 PFAM
low complexity region 388 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198008
AA Change: R58W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143041
Gene: ENSMUSG00000045790
AA Change: R58W

DomainStartEndE-ValueType
Pfam:DUF2353 21 138 1.5e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Mpp6 T C 6: 50,163,655 probably null Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Myo15b G T 11: 115,890,714 probably null Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rfc5 T A 5: 117,387,866 probably null Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
Skp2 T C 15: 9,139,428 probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Ccdc149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Ccdc149 APN 5 52376322 missense probably benign 0.15
IGL02002:Ccdc149 APN 5 52406079 missense probably damaging 1.00
pequeno UTSW 5 52405133 nonsense probably null
R0226:Ccdc149 UTSW 5 52400217 missense probably damaging 1.00
R0420:Ccdc149 UTSW 5 52400239 splice site probably benign
R0959:Ccdc149 UTSW 5 52385155 missense probably damaging 1.00
R2075:Ccdc149 UTSW 5 52439168 missense probably damaging 1.00
R2355:Ccdc149 UTSW 5 52420772 missense probably damaging 0.99
R4755:Ccdc149 UTSW 5 52404151 missense probably damaging 0.96
R5596:Ccdc149 UTSW 5 52404151 missense probably damaging 0.96
R5955:Ccdc149 UTSW 5 52376535 missense probably benign 0.00
R5993:Ccdc149 UTSW 5 52402775 missense probably damaging 1.00
R6351:Ccdc149 UTSW 5 52385135 missense probably benign
R6742:Ccdc149 UTSW 5 52405133 nonsense probably null
R6939:Ccdc149 UTSW 5 52376265 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGGAAGTACGTACATGCAG -3'
(R):5'- AGAAGCCCGCCTGTCATTTC -3'

Sequencing Primer
(F):5'- GAAGGCCTTGAAGTCCTGATC -3'
(R):5'- CTAACCAGTGGCCATTTGTTCTGTAG -3'
Posted On2018-11-28