Incidental Mutation 'R6963:Rnf145'
ID543336
Institutional Source Beutler Lab
Gene Symbol Rnf145
Ensembl Gene ENSMUSG00000019189
Gene Namering finger protein 145
Synonyms3732413I11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6963 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location44518964-44565520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44564277 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 662 (S662P)
Ref Sequence ENSEMBL: ENSMUSP00000019333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019333]
Predicted Effect probably benign
Transcript: ENSMUST00000019333
AA Change: S662P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000019333
Gene: ENSMUSG00000019189
AA Change: S662P

DomainStartEndE-ValueType
Pfam:TRC8_N 8 506 2.8e-156 PFAM
RING 537 574 2.12e-8 SMART
low complexity region 590 601 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150257
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Rnf145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rnf145 APN 11 44555212 missense possibly damaging 0.90
IGL02972:Rnf145 APN 11 44564038 missense probably benign 0.26
IGL03168:Rnf145 APN 11 44555158 missense probably damaging 1.00
IGL03185:Rnf145 APN 11 44531330 missense probably damaging 1.00
IGL02980:Rnf145 UTSW 11 44561657 missense probably benign
R0112:Rnf145 UTSW 11 44564151 missense probably benign
R0346:Rnf145 UTSW 11 44555164 missense probably damaging 1.00
R0415:Rnf145 UTSW 11 44525138 missense probably damaging 0.99
R0452:Rnf145 UTSW 11 44561760 missense probably damaging 1.00
R0487:Rnf145 UTSW 11 44555229 missense probably benign 0.21
R0598:Rnf145 UTSW 11 44548943 missense probably damaging 1.00
R0631:Rnf145 UTSW 11 44560024 missense probably damaging 0.99
R0837:Rnf145 UTSW 11 44524988 missense probably benign 0.00
R1611:Rnf145 UTSW 11 44551798 missense probably damaging 1.00
R1971:Rnf145 UTSW 11 44548815 missense probably damaging 1.00
R1991:Rnf145 UTSW 11 44561466 missense possibly damaging 0.90
R2157:Rnf145 UTSW 11 44555170 missense probably damaging 1.00
R2340:Rnf145 UTSW 11 44531378 missense probably benign 0.04
R3855:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R4483:Rnf145 UTSW 11 44564277 missense probably benign 0.10
R4564:Rnf145 UTSW 11 44548808 missense probably benign 0.25
R4922:Rnf145 UTSW 11 44557236 unclassified probably benign
R5633:Rnf145 UTSW 11 44560088 missense probably damaging 1.00
R5672:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5673:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5701:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5915:Rnf145 UTSW 11 44542722 critical splice donor site probably null
R6128:Rnf145 UTSW 11 44555191 missense probably damaging 1.00
R6502:Rnf145 UTSW 11 44525105 missense probably damaging 0.98
R6717:Rnf145 UTSW 11 44561490 missense probably benign 0.00
R7035:Rnf145 UTSW 11 44561756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAACATTGTACTTCAGGAAGG -3'
(R):5'- GGCCATTCCTGAAGTTGCTG -3'

Sequencing Primer
(F):5'- GTCCTGAACCCCCGGAC -3'
(R):5'- TTTCTCCAACAGCATGAAGTGGG -3'
Posted On2018-11-28