Incidental Mutation 'R6963:Pde9a'
List |< first << previous [record 27 of 38] next >> last >|
ID543343
Institutional Source Beutler Lab
Gene Symbol Pde9a
Ensembl Gene ENSMUSG00000041119
Gene Namephosphodiesterase 9A
SynonymsPDE9A1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R6963 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location31386234-31476310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31443887 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 97 (V97L)
Ref Sequence ENSEMBL: ENSMUSP00000121003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047168] [ENSMUST00000124902] [ENSMUST00000127929] [ENSMUST00000131417] [ENSMUST00000134525] [ENSMUST00000136384] [ENSMUST00000137927] [ENSMUST00000141314] [ENSMUST00000143549]
Predicted Effect probably benign
Transcript: ENSMUST00000047168
AA Change: V123L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038005
Gene: ENSMUSG00000041119
AA Change: V123L

DomainStartEndE-ValueType
HDc 248 415 7.12e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124902
SMART Domains Protein: ENSMUSP00000118869
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 77 3e-47 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000127929
AA Change: V123L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117611
Gene: ENSMUSG00000041119
AA Change: V123L

DomainStartEndE-ValueType
HDc 248 415 7.12e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131417
SMART Domains Protein: ENSMUSP00000115188
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 23 7e-9 PDB
low complexity region 32 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134525
AA Change: V97L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121003
Gene: ENSMUSG00000041119
AA Change: V97L

DomainStartEndE-ValueType
HDc 222 389 7.12e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136384
SMART Domains Protein: ENSMUSP00000116724
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 80 2e-50 PDB
SCOP:d1f0ja_ 28 80 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137927
Predicted Effect probably benign
Transcript: ENSMUST00000141314
SMART Domains Protein: ENSMUSP00000117364
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 72 3e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000143549
SMART Domains Protein: ENSMUSP00000117911
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 23 5e-9 PDB
low complexity region 32 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the hydrolysis of cAMP and cGMP to their corresponding monophosphates. The encoded protein plays a role in signal transduction by regulating the intracellular concentration of these cyclic nucleotides. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit suppressed pressure-overload-induced cardiac pathobiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Mpp6 T C 6: 50,163,655 probably null Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Myo15b G T 11: 115,890,714 probably null Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Rfc5 T A 5: 117,387,866 probably null Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
Skp2 T C 15: 9,139,428 probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Pde9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Pde9a APN 17 31443172 missense probably benign 0.03
IGL01372:Pde9a APN 17 31461711 missense probably benign 0.24
IGL01599:Pde9a APN 17 31414150 missense probably damaging 1.00
IGL02108:Pde9a APN 17 31461693 missense probably benign
IGL02113:Pde9a APN 17 31459970 missense probably benign 0.24
IGL02132:Pde9a APN 17 31453470 missense probably benign 0.15
IGL02320:Pde9a APN 17 31459085 missense probably damaging 1.00
IGL02371:Pde9a APN 17 31420285 missense possibly damaging 0.92
IGL03128:Pde9a APN 17 31459910 missense possibly damaging 0.74
R0015:Pde9a UTSW 17 31386356 splice site probably null
R0281:Pde9a UTSW 17 31455106 missense probably damaging 0.98
R0584:Pde9a UTSW 17 31459977 missense probably damaging 1.00
R1464:Pde9a UTSW 17 31473162 missense probably benign 0.06
R1464:Pde9a UTSW 17 31473162 missense probably benign 0.06
R1853:Pde9a UTSW 17 31455120 missense probably damaging 1.00
R1855:Pde9a UTSW 17 31455120 missense probably damaging 1.00
R2134:Pde9a UTSW 17 31386310 missense probably damaging 1.00
R3732:Pde9a UTSW 17 31448427 missense possibly damaging 0.60
R4066:Pde9a UTSW 17 31443838 makesense probably null
R4841:Pde9a UTSW 17 31443161 splice site probably null
R4842:Pde9a UTSW 17 31443161 splice site probably null
R4978:Pde9a UTSW 17 31473223 missense probably benign 0.01
R6826:Pde9a UTSW 17 31466440 missense probably benign 0.02
R6860:Pde9a UTSW 17 31470724 missense probably damaging 1.00
R6912:Pde9a UTSW 17 31466412 missense possibly damaging 0.95
R6965:Pde9a UTSW 17 31443887 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTTCTTTAAAAGCACCTCCTG -3'
(R):5'- GTGCTTTAACAGAAACGTGTGC -3'

Sequencing Primer
(F):5'- GCACCTCCTGCTGTCTTGG -3'
(R):5'- AAACGTGTGCTGAGATCTGCC -3'
Posted On2018-11-28