Incidental Mutation 'R6969:Dnttip2'
ID543361
Institutional Source Beutler Lab
Gene Symbol Dnttip2
Ensembl Gene ENSMUSG00000039756
Gene Namedeoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms4930588M11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location122274388-122285271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122282492 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 691 (Q691R)
Ref Sequence ENSEMBL: ENSMUSP00000045043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035776]
Predicted Effect probably damaging
Transcript: ENSMUST00000035776
AA Change: Q691R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045043
Gene: ENSMUSG00000039756
AA Change: Q691R

DomainStartEndE-ValueType
low complexity region 125 143 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
coiled coil region 513 541 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Pfam:Fcf2 639 733 3.4e-41 PFAM
low complexity region 748 756 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be involved in chromatin remodeling and gene transcription. The encoded nuclear protein binds to and enhances the transcriptional activity of the estrogen receptor alpha, and also interacts with terminal deoxynucleotidyltransferase. The expression profile of this gene is a potential biomarker for chronic obstructive pulmonary disease. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Dnttip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Dnttip2 APN 3 122284499 missense probably damaging 1.00
IGL00921:Dnttip2 APN 3 122275290 missense probably benign 0.03
IGL01120:Dnttip2 APN 3 122278737 splice site probably benign
IGL01341:Dnttip2 APN 3 122276612 missense probably damaging 1.00
IGL01636:Dnttip2 APN 3 122282474 missense possibly damaging 0.95
IGL01988:Dnttip2 APN 3 122276295 missense probably benign 0.05
IGL02096:Dnttip2 APN 3 122284413 missense possibly damaging 0.51
IGL02216:Dnttip2 APN 3 122276261 missense probably benign 0.01
IGL03234:Dnttip2 APN 3 122282438 missense probably damaging 1.00
abyss UTSW 3 122276221 missense probably damaging 0.99
chasm UTSW 3 122275808 missense probably damaging 1.00
R0089:Dnttip2 UTSW 3 122275462 missense possibly damaging 0.59
R0102:Dnttip2 UTSW 3 122275803 missense probably benign 0.00
R0102:Dnttip2 UTSW 3 122275803 missense probably benign 0.00
R0195:Dnttip2 UTSW 3 122276161 missense probably benign 0.02
R1103:Dnttip2 UTSW 3 122276422 missense probably benign 0.02
R1733:Dnttip2 UTSW 3 122276748 missense probably benign 0.25
R1759:Dnttip2 UTSW 3 122276149 missense probably benign 0.21
R2019:Dnttip2 UTSW 3 122280744 missense possibly damaging 0.93
R2022:Dnttip2 UTSW 3 122276221 missense probably damaging 1.00
R2415:Dnttip2 UTSW 3 122276537 missense probably damaging 1.00
R3913:Dnttip2 UTSW 3 122275391 missense possibly damaging 0.68
R4194:Dnttip2 UTSW 3 122280761 missense probably damaging 1.00
R4367:Dnttip2 UTSW 3 122276497 missense probably damaging 1.00
R4871:Dnttip2 UTSW 3 122285101 missense probably damaging 1.00
R4888:Dnttip2 UTSW 3 122276592 missense probably damaging 1.00
R5082:Dnttip2 UTSW 3 122275941 missense probably damaging 0.98
R5436:Dnttip2 UTSW 3 122278769 missense probably damaging 1.00
R5483:Dnttip2 UTSW 3 122276797 missense probably damaging 0.97
R5933:Dnttip2 UTSW 3 122275568 missense probably benign 0.07
R5966:Dnttip2 UTSW 3 122285168 utr 3 prime probably benign
R6171:Dnttip2 UTSW 3 122278862 missense probably damaging 0.99
R6251:Dnttip2 UTSW 3 122275256 missense probably benign 0.14
R6286:Dnttip2 UTSW 3 122284400 missense probably damaging 1.00
R6512:Dnttip2 UTSW 3 122275523 missense possibly damaging 0.67
R6519:Dnttip2 UTSW 3 122275471 missense probably benign 0.05
R6670:Dnttip2 UTSW 3 122276221 missense probably damaging 0.99
R6833:Dnttip2 UTSW 3 122276803 missense probably damaging 0.99
R6870:Dnttip2 UTSW 3 122275808 missense probably damaging 1.00
R7038:Dnttip2 UTSW 3 122276532 nonsense probably null
R7233:Dnttip2 UTSW 3 122276390 missense probably benign 0.26
R7423:Dnttip2 UTSW 3 122275526 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAACCCAGCAGGCAGTGTG -3'
(R):5'- GGTACCCATTATAAAACGGTGGC -3'

Sequencing Primer
(F):5'- TCTCACAGAGGGTCAGCTTG -3'
(R):5'- CCCATTATAAAACGGTGGCTATGTG -3'
Posted On2018-11-28