Incidental Mutation 'R6969:Unc13b'
ID543363
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Nameunc-13 homolog B (C. elegans)
SynonymsUnc13h2, Munc13-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43058953-43264871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43263538 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1587 (F1587L)
Ref Sequence ENSEMBL: ENSMUSP00000128608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000102953] [ENSMUST00000107937] [ENSMUST00000107942] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000136262] [ENSMUST00000163653] [ENSMUST00000207569] [ENSMUST00000207708]
Predicted Effect probably benign
Transcript: ENSMUST00000079978
AA Change: F1576L

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456
AA Change: F1576L

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102953
SMART Domains Protein: ENSMUSP00000100018
Gene: ENSMUSG00000028457

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
Blast:CUB 55 90 1e-6 BLAST
Pfam:E1-E2_ATPase 107 305 4.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect probably benign
Transcript: ENSMUST00000107942
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107952
AA Change: F1588L

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456
AA Change: F1588L

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107953
AA Change: F1595L

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456
AA Change: F1595L

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136262
Predicted Effect possibly damaging
Transcript: ENSMUST00000163653
AA Change: F1587L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456
AA Change: F1587L

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207569
AA Change: F4376L

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207708
AA Change: F1968L

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43091298 missense probably benign 0.03
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R1839:Unc13b UTSW 4 43258308 splice site probably benign
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2259:Unc13b UTSW 4 43182780 missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6242:Unc13b UTSW 4 43165800 missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6753:Unc13b UTSW 4 43239331 missense probably damaging 1.00
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7117:Unc13b UTSW 4 43216544 missense probably benign 0.33
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
R7517:Unc13b UTSW 4 43215765 missense probably benign
R7532:Unc13b UTSW 4 43249565 missense probably benign 0.44
R7564:Unc13b UTSW 4 43091258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAGGATTACTGCTTTGCC -3'
(R):5'- AGCCATAGTCTTACTGCCCC -3'

Sequencing Primer
(F):5'- ATTACTGCTTTGCCCGGGAG -3'
(R):5'- CTTAGACATCCTAACTGGGAGAGTC -3'
Posted On2018-11-28