Incidental Mutation 'R6969:Lrrc19'
ID543366
Institutional Source Beutler Lab
Gene Symbol Lrrc19
Ensembl Gene ENSMUSG00000049799
Gene Nameleucine rich repeat containing 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location94636653-94650144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94639373 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 200 (N200K)
Ref Sequence ENSEMBL: ENSMUSP00000102718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030311] [ENSMUST00000053419] [ENSMUST00000107101] [ENSMUST00000107104]
Predicted Effect probably benign
Transcript: ENSMUST00000030311
SMART Domains Protein: ENSMUSP00000030311
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 382 N/A INTRINSIC
coiled coil region 430 490 N/A INTRINSIC
coiled coil region 512 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053419
AA Change: N200K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056094
Gene: ENSMUSG00000049799
AA Change: N200K

DomainStartEndE-ValueType
LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 250 364 8.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107101
AA Change: N200K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102718
Gene: ENSMUSG00000049799
AA Change: N200K

DomainStartEndE-ValueType
LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 245 364 9.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107104
SMART Domains Protein: ENSMUSP00000102721
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Lrrc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Lrrc19 APN 4 94638508 missense probably damaging 0.99
IGL02585:Lrrc19 APN 4 94643325 missense probably benign 0.00
R0087:Lrrc19 UTSW 4 94640772 missense probably damaging 1.00
R0629:Lrrc19 UTSW 4 94638252 missense probably damaging 1.00
R1172:Lrrc19 UTSW 4 94638389 nonsense probably null
R1572:Lrrc19 UTSW 4 94638429 missense probably damaging 1.00
R1576:Lrrc19 UTSW 4 94639353 missense probably damaging 1.00
R1589:Lrrc19 UTSW 4 94640950 missense probably benign 0.24
R2107:Lrrc19 UTSW 4 94639294 missense probably benign
R4734:Lrrc19 UTSW 4 94638349 missense probably benign 0.01
R4932:Lrrc19 UTSW 4 94640937 missense probably damaging 1.00
R6079:Lrrc19 UTSW 4 94643343 missense probably benign 0.17
R7293:Lrrc19 UTSW 4 94638390 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CATTACCTGAGGTCCATGTTAAGTTG -3'
(R):5'- TGACATGCAAACTGAGTCACTATC -3'

Sequencing Primer
(F):5'- CCATGTTAAGTTGTGTGAAGAGC -3'
(R):5'- GCACCATATGTATACCTGGTGACTG -3'
Posted On2018-11-28