Incidental Mutation 'R6969:Zfp59'
ID543377
Institutional Source Beutler Lab
Gene Symbol Zfp59
Ensembl Gene ENSMUSG00000078779
Gene Namezinc finger protein 59
SynonymsMfg2, Mfg-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27838607-27856438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27853497 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 125 (S125P)
Ref Sequence ENSEMBL: ENSMUSP00000145671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108331] [ENSMUST00000205701] [ENSMUST00000205715]
Predicted Effect probably damaging
Transcript: ENSMUST00000108331
AA Change: S125P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103968
Gene: ENSMUSG00000078779
AA Change: S125P

DomainStartEndE-ValueType
KRAB 14 75 1.2e-35 SMART
ZnF_C2H2 172 194 2.91e-2 SMART
ZnF_C2H2 200 222 1.95e-3 SMART
ZnF_C2H2 256 278 2.02e-1 SMART
ZnF_C2H2 284 306 3.21e-4 SMART
ZnF_C2H2 312 334 1.92e-2 SMART
ZnF_C2H2 340 362 1.22e-4 SMART
ZnF_C2H2 368 390 2.53e-2 SMART
ZnF_C2H2 396 418 6.78e-3 SMART
ZnF_C2H2 424 446 3.44e-4 SMART
ZnF_C2H2 452 474 1.38e-3 SMART
ZnF_C2H2 480 502 3.34e-2 SMART
ZnF_C2H2 508 530 2.2e-2 SMART
ZnF_C2H2 536 558 2.71e-2 SMART
ZnF_C2H2 564 586 2.4e-3 SMART
ZnF_C2H2 592 614 1.92e-2 SMART
ZnF_C2H2 620 642 2.57e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205701
AA Change: S125P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000205715
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: The Krueppel-associated box (KRAB) is a domain of around 75 amino acids found in the N-terminal portion of about one third of eukaryotic Krueppel-type C2H2 zinc finger proteins (ZFPs). The KRAB domain functions as a transcriptional repressor when tethered to the template DNA by a DNA-binding domain. Although the function of KRAB-ZFPs is largely unknown, they appear to play important roles during cell differentiation and development. This gene encodes a protein belonging to the Krueppel family of C2H2-type zinc finger proteins and has been shown to accumulate in the nuclei of mature sperm in association with the nuclear matrix. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Zfp59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02976:Zfp59 APN 7 27853396 missense probably benign 0.00
R0689:Zfp59 UTSW 7 27853717 missense probably benign 0.19
R0726:Zfp59 UTSW 7 27854088 missense probably damaging 0.98
R1570:Zfp59 UTSW 7 27853591 missense probably benign 0.03
R1587:Zfp59 UTSW 7 27854134 missense possibly damaging 0.84
R2067:Zfp59 UTSW 7 27853510 missense probably benign 0.01
R4880:Zfp59 UTSW 7 27844317 missense probably damaging 0.99
R5677:Zfp59 UTSW 7 27854169 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GCTCCCATACAGCTTCTCAG -3'
(R):5'- CACTTCTGATGCCTTGTGAGC -3'

Sequencing Primer
(F):5'- TCCCATACAGCTTCTCAGAGATTAC -3'
(R):5'- CACTCTGATGCTGAGTAAGAGTTGAC -3'
Posted On2018-11-28