Incidental Mutation 'R6969:Smarcc1'
ID543392
Institutional Source Beutler Lab
Gene Symbol Smarcc1
Ensembl Gene ENSMUSG00000032481
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
SynonymsBAF155, SRG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6969 (G1)
Quality Score216.009
Status Not validated
Chromosome9
Chromosomal Location110117708-110240178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 110196320 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 688 (S688R)
Ref Sequence ENSEMBL: ENSMUSP00000086094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088716] [ENSMUST00000197984] [ENSMUST00000199896]
Predicted Effect probably damaging
Transcript: ENSMUST00000088716
AA Change: S688R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086094
Gene: ENSMUSG00000032481
AA Change: S688R

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.7e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 9.6e-35 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 2.5e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
low complexity region 1075 1104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197984
AA Change: S688R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142611
Gene: ENSMUSG00000032481
AA Change: S688R

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 448 536 1.4e-35 PFAM
SANT 618 666 4.52e-12 SMART
low complexity region 710 717 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 768 781 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 866 885 N/A INTRINSIC
coiled coil region 909 945 N/A INTRINSIC
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199896
AA Change: S688R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143550
Gene: ENSMUSG00000032481
AA Change: S688R

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.5e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 1.4e-34 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 1.4e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out mutation display early embryonic lethality soon after decidualization due to failed egg cylinder formation and defects in the inner cell mass and primitive endoderm. About 20% of heterozygous mutant embryos show exencephaly caused by failure in neural fold elevation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Smarcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Smarcc1 APN 9 110221937 missense probably damaging 1.00
IGL01152:Smarcc1 APN 9 110139625 missense possibly damaging 0.89
IGL01353:Smarcc1 APN 9 110135666 missense probably benign 0.07
IGL01401:Smarcc1 APN 9 110149965 missense possibly damaging 0.52
IGL01483:Smarcc1 APN 9 110222060 nonsense probably null
IGL01679:Smarcc1 APN 9 110213530 missense probably damaging 1.00
IGL02458:Smarcc1 APN 9 110132126 intron probably benign
IGL02498:Smarcc1 APN 9 110190934 missense probably damaging 1.00
IGL02605:Smarcc1 APN 9 110222000 missense possibly damaging 0.86
IGL03003:Smarcc1 APN 9 110206100 missense probably damaging 0.97
IGL03284:Smarcc1 APN 9 110175074 missense probably benign 0.30
R0116:Smarcc1 UTSW 9 110147104 missense possibly damaging 0.71
R0403:Smarcc1 UTSW 9 110237808 splice site probably null
R1436:Smarcc1 UTSW 9 110118640 unclassified probably benign
R1583:Smarcc1 UTSW 9 110213617 missense probably damaging 1.00
R1692:Smarcc1 UTSW 9 110174004 missense possibly damaging 0.85
R1732:Smarcc1 UTSW 9 110185820 splice site probably benign
R1833:Smarcc1 UTSW 9 110153811 missense possibly damaging 0.71
R1881:Smarcc1 UTSW 9 110175099 missense probably damaging 1.00
R2058:Smarcc1 UTSW 9 110118343 unclassified probably benign
R2175:Smarcc1 UTSW 9 110164809 missense possibly damaging 0.71
R2215:Smarcc1 UTSW 9 110237839 utr 3 prime probably benign
R2904:Smarcc1 UTSW 9 110173975 missense possibly damaging 0.80
R3899:Smarcc1 UTSW 9 110118518 unclassified probably benign
R3900:Smarcc1 UTSW 9 110118518 unclassified probably benign
R4012:Smarcc1 UTSW 9 110132205 missense possibly damaging 0.96
R4091:Smarcc1 UTSW 9 110164829 missense possibly damaging 0.84
R4356:Smarcc1 UTSW 9 110196256 missense probably damaging 0.99
R4881:Smarcc1 UTSW 9 110135628 start gained probably benign
R4993:Smarcc1 UTSW 9 110175061 missense probably damaging 1.00
R5110:Smarcc1 UTSW 9 110197784 missense possibly damaging 0.89
R5375:Smarcc1 UTSW 9 110190949 missense probably damaging 0.99
R5655:Smarcc1 UTSW 9 110157344 missense probably null 1.00
R5715:Smarcc1 UTSW 9 110196367 missense possibly damaging 0.95
R5767:Smarcc1 UTSW 9 110132183 intron probably benign
R5816:Smarcc1 UTSW 9 110197644 missense possibly damaging 0.51
R7068:Smarcc1 UTSW 9 110185884 missense probably damaging 1.00
R7211:Smarcc1 UTSW 9 110150014 missense probably damaging 0.97
T0722:Smarcc1 UTSW 9 110206085 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGCTCTGGAGATGTACAAGGAC -3'
(R):5'- ACCTCCCAGGAGAAATGCTATC -3'

Sequencing Primer
(F):5'- CTCTGGAGATGTACAAGGACGATTG -3'
(R):5'- TCCGTAGCAGAGTTGATACACCTG -3'
Posted On2018-11-28