Incidental Mutation 'R6969:Arhgap9'
ID543394
Institutional Source Beutler Lab
Gene Symbol Arhgap9
Ensembl Gene ENSMUSG00000040345
Gene NameRho GTPase activating protein 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6969 (G1)
Quality Score95.0077
Status Not validated
Chromosome10
Chromosomal Location127321964-127329943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127326643 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 348 (E348K)
Ref Sequence ENSEMBL: ENSMUSP00000151690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026474] [ENSMUST00000069548] [ENSMUST00000219026] [ENSMUST00000219511]
Predicted Effect probably benign
Transcript: ENSMUST00000026474
SMART Domains Protein: ENSMUSP00000026474
Gene: ENSMUSG00000025407

DomainStartEndE-ValueType
low complexity region 222 237 N/A INTRINSIC
ZnF_C2H2 238 263 1.33e-1 SMART
ZnF_C2H2 271 298 5.72e-1 SMART
ZnF_C2H2 304 328 2.57e-3 SMART
ZnF_C2H2 334 359 1.92e-2 SMART
ZnF_C2H2 365 390 2.61e-4 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 850 873 N/A INTRINSIC
low complexity region 941 962 N/A INTRINSIC
low complexity region 985 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069548
AA Change: E173K

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066455
Gene: ENSMUSG00000040345
AA Change: E173K

DomainStartEndE-ValueType
PH 60 175 8.19e-10 SMART
RhoGAP 276 469 1.94e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219026
AA Change: E173K

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000219511
AA Change: E348K

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-GAP family of GTPase activating proteins. The protein has substantial GAP activity towards several Rho-family GTPases in vitro, converting them to an inactive GDP-bound state. It is implicated in regulating adhesion of hematopoietic cells to the extracellular matrix. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Arhgap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Arhgap9 APN 10 127327893 splice site probably benign
IGL01069:Arhgap9 APN 10 127328952 missense probably damaging 1.00
IGL02444:Arhgap9 APN 10 127327947 missense probably damaging 1.00
IGL02707:Arhgap9 APN 10 127329607 missense probably damaging 0.98
R0242:Arhgap9 UTSW 10 127329538 missense probably benign 0.13
R0242:Arhgap9 UTSW 10 127329538 missense probably benign 0.13
R0841:Arhgap9 UTSW 10 127329639 missense probably damaging 0.98
R1084:Arhgap9 UTSW 10 127327928 missense probably damaging 1.00
R1707:Arhgap9 UTSW 10 127328889 missense probably benign 0.00
R1799:Arhgap9 UTSW 10 127327724 missense probably damaging 1.00
R2423:Arhgap9 UTSW 10 127327124 unclassified probably null
R2511:Arhgap9 UTSW 10 127328985 critical splice donor site probably null
R3721:Arhgap9 UTSW 10 127328971 missense possibly damaging 0.84
R3803:Arhgap9 UTSW 10 127329517 missense possibly damaging 0.64
R4261:Arhgap9 UTSW 10 127328465 missense probably damaging 1.00
R4968:Arhgap9 UTSW 10 127327006 missense possibly damaging 0.80
R5423:Arhgap9 UTSW 10 127329549 missense probably damaging 1.00
R5425:Arhgap9 UTSW 10 127326418 missense probably damaging 1.00
R6697:Arhgap9 UTSW 10 127322120 missense probably benign 0.34
X0067:Arhgap9 UTSW 10 127328432 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTCCTCGCAGCGTTTTAG -3'
(R):5'- ACACCGGTTCCGATTCCAATTC -3'

Sequencing Primer
(F):5'- GCAGCGTTTTAGGCACTCCTAG -3'
(R):5'- TTGGACAGGAGAACATCTGCACC -3'
Posted On2018-11-28