Incidental Mutation 'R6969:Ap2b1'
ID543398
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Nameadaptor-related protein complex 2, beta 1 subunit
Synonyms1300012O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location83299024-83405035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83389726 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 788 (D788E)
Ref Sequence ENSEMBL: ENSMUSP00000135445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]
Predicted Effect probably benign
Transcript: ENSMUST00000018875
AA Change: D826E

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: D826E

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065692
AA Change: D812E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: D812E

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176430
AA Change: D826E

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: D826E

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176523
AA Change: D788E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: D788E

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83333158 missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83324611 missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83321973 missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83335530 missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83346766 missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83336799 missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83341384 missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83368026 missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83321967 missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83367874 splice site probably benign
R1222:Ap2b1 UTSW 11 83346738 missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83333109 missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83346831 missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83324604 missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83390735 missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83390735 missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83346895 missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83346895 missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83336386 missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83351118 missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83324761 splice site probably benign
R3615:Ap2b1 UTSW 11 83324565 missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83324565 missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83390716 missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83365645 critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83365645 critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83342603 missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83335604 critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83324650 missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83397779 missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83333011 nonsense probably null
R4916:Ap2b1 UTSW 11 83390706 missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83339392 missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83342601 missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83336737 intron probably null
R5738:Ap2b1 UTSW 11 83336430 unclassified probably null
R6023:Ap2b1 UTSW 11 83335398 missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83346673 missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83346825 missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83308239 start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83342679 missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83335491 missense possibly damaging 0.89
R7238:Ap2b1 UTSW 11 83333122 missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83351105 missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83367998 missense probably benign 0.00
X0064:Ap2b1 UTSW 11 83324569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGAGGGTATACCATAGTC -3'
(R):5'- AGTGACTGGCAAATGACCAATG -3'

Sequencing Primer
(F):5'- CTGGAGGGTATACCATAGTCTTCTAG -3'
(R):5'- CCAATGATCAACTACTTATTGGGGC -3'
Posted On2018-11-28