Incidental Mutation 'R6969:Kcnh8'
ID543414
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 8
SynonymsELK1, C130090D05Rik, Kv12.1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location52602709-52979194 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 52877943 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 418 (R418*)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
Predicted Effect probably null
Transcript: ENSMUST00000039366
AA Change: R418*
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: R418*

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCACCACCAATCACTTTG -3'
(R):5'- CATCTGGAGACTCAGTTCCC -3'

Sequencing Primer
(F):5'- ATAACCTGATCGTTCCTTTTTAACTC -3'
(R):5'- AGTTCCCTTTCTTGCTCCTGAAAAAG -3'
Posted On2018-11-28