Incidental Mutation 'R6481:Abi2'
ID543428
Institutional Source Beutler Lab
Gene Symbol Abi2
Ensembl Gene ENSMUSG00000026782
Gene Nameabl-interactor 2
Synonyms8430425M24Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001198570.1, NM_001198571.1, NM_198127.2; Ensembl: ENSMUST00000052332, ENSMUST00000087417

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6481 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location60409619-60481158 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 60438939 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000185788] [ENSMUST00000186097] [ENSMUST00000188618] [ENSMUST00000189082] [ENSMUST00000189980]
Predicted Effect probably null
Transcript: ENSMUST00000185788
SMART Domains Protein: ENSMUSP00000139483
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 67 4.4e-25 PFAM
low complexity region 68 81 N/A INTRINSIC
low complexity region 83 115 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 249 284 N/A INTRINSIC
SH3 301 356 3.4e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000186097
SMART Domains Protein: ENSMUSP00000139501
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 95 121 N/A INTRINSIC
low complexity region 125 143 N/A INTRINSIC
low complexity region 284 319 N/A INTRINSIC
SH3 336 391 3.4e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188618
SMART Domains Protein: ENSMUSP00000140274
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5.1e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
low complexity region 402 437 N/A INTRINSIC
SH3 454 487 2.29e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189082
SMART Domains Protein: ENSMUSP00000140522
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 38 115 5.8e-34 PFAM
low complexity region 116 129 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000189980
SMART Domains Protein: ENSMUSP00000141068
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 369 404 N/A INTRINSIC
SH3 421 476 5.55e-24 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (82/82)
MGI Phenotype PHENOTYPE: Homozygous null mice display microphthalmia, abnormal lens development, abnormal corpus callosum, cerebral cortex, and hippocampus morphology, and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik T C 1: 31,222,507 probably benign Het
5430419D17Rik A T 7: 131,256,801 D1066V probably benign Het
6430573F11Rik T C 8: 36,498,483 probably null Het
Abca9 G A 11: 110,165,962 Q11* probably null Het
Abcc9 A T 6: 142,604,895 M1273K probably damaging Het
Acsm5 A G 7: 119,534,881 E295G probably benign Het
Anapc5 T C 5: 122,800,544 D389G probably benign Het
Ano3 A T 2: 110,795,027 D159E probably benign Het
Arhgap26 T A 18: 39,150,057 M349K probably damaging Het
Arhgef39 A G 4: 43,498,580 probably null Het
Astn1 T C 1: 158,612,462 S867P probably benign Het
Atad3a A T 4: 155,753,641 probably null Het
Cadm1 A T 9: 47,788,109 D91V probably damaging Het
Cc2d2b T C 19: 40,802,395 I933T possibly damaging Het
Celsr3 C G 9: 108,837,084 N1937K possibly damaging Het
Cic A C 7: 25,288,281 T558P possibly damaging Het
Cntln A G 4: 85,067,510 M933V probably benign Het
Coch T C 12: 51,598,173 F170S probably damaging Het
Col1a2 A G 6: 4,538,680 Y1200C unknown Het
Col26a1 T C 5: 136,744,178 M383V probably benign Het
Col4a4 A T 1: 82,453,778 M1595K unknown Het
Crh T C 3: 19,694,337 E47G probably benign Het
Cyhr1 T C 15: 76,658,708 probably null Het
D930020B18Rik T C 10: 121,661,148 probably null Het
Def6 G A 17: 28,226,163 R482H probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpagt1 T C 9: 44,331,190 L241P probably damaging Het
E2f7 A G 10: 110,774,681 E389G probably damaging Het
Eif2b1 T C 5: 124,577,111 I53V probably benign Het
Fbxo4 A G 15: 3,965,734 L376P probably damaging Het
Fgfr2 A G 7: 130,185,278 S352P possibly damaging Het
Fkbpl C A 17: 34,645,414 P52Q possibly damaging Het
Fry G A 5: 150,386,014 R641H probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm12728 A G 4: 105,794,349 K52R probably damaging Het
Gm8298 T C 3: 59,861,057 Y3H probably benign Het
Gtf2a1l A G 17: 88,711,625 D379G probably benign Het
Gys1 A T 7: 45,442,969 Y332F possibly damaging Het
Hoxa7 T A 6: 52,216,614 probably benign Het
Ifitm1 G A 7: 140,969,606 V101I probably benign Het
Kalrn T A 16: 34,360,984 T95S probably damaging Het
Leng8 A G 7: 4,145,413 Y728C probably damaging Het
Lonp2 G T 8: 86,634,908 D238Y possibly damaging Het
Ltn1 A C 16: 87,378,980 S1757A probably damaging Het
Man2a2 A T 7: 80,364,071 S411T probably damaging Het
Mrps33 C A 6: 39,805,370 probably null Het
Muc16 C T 9: 18,550,677 probably null Het
Muc5ac A G 7: 141,809,071 probably benign Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Olfr1141 T C 2: 87,753,468 N175S probably damaging Het
Olfr1204 A T 2: 88,852,519 T190S probably damaging Het
Olfr122 T G 17: 37,772,303 F217V probably damaging Het
Olfr1340 A G 4: 118,726,733 Y162C probably damaging Het
Olfr50 T A 2: 36,793,777 D180E possibly damaging Het
Olfr545 A T 7: 102,494,139 V212D probably damaging Het
Pag1 T A 3: 9,699,336 E252D possibly damaging Het
Plcd3 T C 11: 103,077,767 Y366C probably damaging Het
Psg17 A C 7: 18,814,450 S465R probably damaging Het
Ptpn9 G T 9: 57,023,040 V50L probably damaging Het
Rab17 T G 1: 90,958,961 S190R probably benign Het
Samd11 A G 4: 156,249,078 probably null Het
Slc17a5 A G 9: 78,538,271 F434S possibly damaging Het
Slc22a15 A G 3: 101,883,583 I202T possibly damaging Het
Slc8a1 G T 17: 81,388,918 Q896K probably benign Het
Slc9a5 A T 8: 105,358,393 K509* probably null Het
Slf2 A C 19: 44,973,164 M1041L probably benign Het
Smn1 A G 13: 100,128,500 probably null Het
Snx9 T C 17: 5,922,209 probably null Het
Soat2 T A 15: 102,162,055 L431Q probably damaging Het
Spam1 T A 6: 24,796,930 N293K probably benign Het
Tatdn1 T C 15: 58,923,911 T66A possibly damaging Het
Tmprss11g A T 5: 86,492,156 S205T probably benign Het
Tnpo3 G T 6: 29,571,101 N431K possibly damaging Het
Trim39 T C 17: 36,268,662 T31A probably benign Het
Tshz3 A G 7: 36,752,339 probably null Het
Ttll11 G A 2: 35,902,754 T359M probably damaging Het
Ttn T G 2: 76,741,499 D26350A probably damaging Het
Ubr4 G T 4: 139,431,751 V2472F probably damaging Het
Vsx2 C T 12: 84,593,104 P265S probably benign Het
Wdr90 C T 17: 25,845,911 G1708R probably damaging Het
Wnt11 A G 7: 98,853,274 Y351C probably damaging Het
Xpo6 A C 7: 126,112,885 N3K probably damaging Het
Zfp445 A G 9: 122,857,566 S165P probably benign Het
Zfp953 A T 13: 67,347,937 Y13* probably null Het
Other mutations in Abi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Abi2 APN 1 60447346 missense probably damaging 1.00
IGL01369:Abi2 APN 1 60437056 missense probably damaging 1.00
IGL02028:Abi2 APN 1 60434283 missense probably damaging 1.00
IGL02074:Abi2 APN 1 60447307 missense probably damaging 1.00
IGL02897:Abi2 APN 1 60448194 missense probably damaging 0.96
IGL02957:Abi2 APN 1 60470786 missense probably damaging 1.00
1mM(1):Abi2 UTSW 1 60437057 missense probably damaging 1.00
P0026:Abi2 UTSW 1 60453723 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R3946:Abi2 UTSW 1 60453754 missense probably damaging 1.00
R4793:Abi2 UTSW 1 60409804 start codon destroyed probably null 1.00
R5110:Abi2 UTSW 1 60450121 missense probably benign 0.00
R5557:Abi2 UTSW 1 60438912 unclassified probably benign
R6037:Abi2 UTSW 1 60464579 missense probably damaging 1.00
R6037:Abi2 UTSW 1 60464579 missense probably damaging 1.00
R6368:Abi2 UTSW 1 60453651 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCATGACACATCTGCTTTAACC -3'
(R):5'- AGCATATTAGTTGGCCCTCC -3'

Sequencing Primer
(F):5'- GACACATCTGCTTTAACCACTCTTTC -3'
(R):5'- TGGTACTGTTCTAGGCACAAAG -3'
Posted On2018-12-11