Incidental Mutation 'R6545:Lin54'
ID543441
Institutional Source Beutler Lab
Gene Symbol Lin54
Ensembl Gene ENSMUSG00000035310
Gene Namelin-54 homolog (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.880) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location100441918-100500639 bp(-) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) T to A at 100485137 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046154] [ENSMUST00000123572] [ENSMUST00000152387]
Predicted Effect probably null
Transcript: ENSMUST00000046154
SMART Domains Protein: ENSMUSP00000041374
Gene: ENSMUSG00000035310

DomainStartEndE-ValueType
low complexity region 364 382 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
CXC 520 560 3.06e-15 SMART
CXC 594 635 1.84e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123572
SMART Domains Protein: ENSMUSP00000123425
Gene: ENSMUSG00000035310

DomainStartEndE-ValueType
low complexity region 364 382 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
CXC 520 560 3.06e-15 SMART
CXC 594 635 1.84e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000152387
SMART Domains Protein: ENSMUSP00000121902
Gene: ENSMUSG00000035310

DomainStartEndE-ValueType
low complexity region 218 231 N/A INTRINSIC
low complexity region 275 293 N/A INTRINSIC
low complexity region 315 330 N/A INTRINSIC
CXC 431 471 3.06e-15 SMART
CXC 505 546 1.84e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIN54 is a component of the LIN, or DREAM, complex, an essential regulator of cell cycle genes (Schmit et al., 2009 [PubMed 19725879]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Lin54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Lin54 APN 5 100485607 missense probably benign 0.03
IGL01356:Lin54 APN 5 100454017 missense probably damaging 0.98
IGL02931:Lin54 APN 5 100480321 missense possibly damaging 0.93
IGL03089:Lin54 APN 5 100450993 missense probably damaging 1.00
IGL03095:Lin54 APN 5 100454478 missense probably damaging 0.99
IGL03202:Lin54 APN 5 100475814 missense possibly damaging 0.92
R0505:Lin54 UTSW 5 100452293 missense probably damaging 0.98
R1138:Lin54 UTSW 5 100444134 missense probably damaging 0.98
R1540:Lin54 UTSW 5 100480250 missense probably damaging 0.99
R1719:Lin54 UTSW 5 100485249 missense possibly damaging 0.91
R1991:Lin54 UTSW 5 100485801 critical splice donor site probably null
R2698:Lin54 UTSW 5 100480250 missense probably damaging 0.99
R3738:Lin54 UTSW 5 100459806 splice site probably benign
R4238:Lin54 UTSW 5 100475744 missense possibly damaging 0.45
R4424:Lin54 UTSW 5 100446560 missense probably damaging 0.98
R4529:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4530:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4531:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4532:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4533:Lin54 UTSW 5 100485403 missense possibly damaging 0.79
R4665:Lin54 UTSW 5 100453084 missense possibly damaging 0.92
R4784:Lin54 UTSW 5 100459738 missense probably damaging 0.99
R4785:Lin54 UTSW 5 100459738 missense probably damaging 0.99
R5252:Lin54 UTSW 5 100480204 missense probably benign
R5265:Lin54 UTSW 5 100485519 missense probably damaging 1.00
R7150:Lin54 UTSW 5 100485300 missense possibly damaging 0.74
X0025:Lin54 UTSW 5 100454443 missense probably benign 0.11
X0026:Lin54 UTSW 5 100450999 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCCAGCAAAATAATACTCTGTAGCC -3'
(R):5'- GGAGATGCTAAGTTACCACCG -3'

Sequencing Primer
(F):5'- AACTTAGTTTGCTATAAGTTCTCTGG -3'
(R):5'- GTTACCACCGCAGCAAATTAAAGTAG -3'
Posted On2018-12-13