Incidental Mutation 'R6591:Amn'
ID 543480
Institutional Source Beutler Lab
Gene Symbol Amn
Ensembl Gene ENSMUSG00000021278
Gene Name amnionless
Synonyms 5033428N14Rik
MMRRC Submission 044715-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6591 (G1)
Quality Score 76.0075
Status Validated
Chromosome 12
Chromosomal Location 111237530-111242860 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111241831 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 299 (H299R)
Ref Sequence ENSEMBL: ENSMUSP00000021707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021707]
AlphaFold Q99JB7
Predicted Effect possibly damaging
Transcript: ENSMUST00000021707
AA Change: H299R

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021707
Gene: ENSMUSG00000021278
AA Change: H299R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Amnionless 21 451 6.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220903
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein. The encoded protein is an essential component of the cubulin receptor complex which is thought to play a role in coordinating growth and patterning of the embryo. This protein is thought to modulate a bone morphogenetic protein (BMP) signaling pathway. A homoygous mutation in the mouse gene results in the lack of an amnion in embryos. Mutations in the human gene are associated with Megaloblastic Anemia-1. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic growth arrest between the mid and late streak stages of gastrulation and abnormal ectoderm formation, followed by death. Generation of middle primitive streak derivatives is impaired, leading to absence of mesoderm and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,306,236 (GRCm39) Y90H probably damaging Het
Agk A G 6: 40,369,624 (GRCm39) D337G probably benign Het
Angptl4 A G 17: 33,999,755 (GRCm39) probably null Het
AU040320 G A 4: 126,730,463 (GRCm39) M563I possibly damaging Het
Cachd1 T C 4: 100,846,683 (GRCm39) M1042T probably benign Het
Cd209c T A 8: 3,995,680 (GRCm39) I41L probably benign Het
Ceacam12 T A 7: 17,803,149 (GRCm39) V185D possibly damaging Het
Chpt1 A T 10: 88,321,762 (GRCm39) probably benign Het
Clca3a1 G C 3: 144,719,644 (GRCm39) A442G probably damaging Het
Cldn8 T C 16: 88,359,423 (GRCm39) I167M possibly damaging Het
Cln3 A G 7: 126,178,606 (GRCm39) V143A possibly damaging Het
Dusp11 T C 6: 85,938,507 (GRCm39) H4R possibly damaging Het
Ephb3 T A 16: 21,033,223 (GRCm39) F69Y probably damaging Het
Gm11099 A T 2: 58,749,485 (GRCm39) probably benign Het
Grik2 A T 10: 49,149,021 (GRCm39) Y521* probably null Het
Igf2r A G 17: 12,907,895 (GRCm39) L2143P probably damaging Het
Kcnk1 T C 8: 126,751,970 (GRCm39) V192A probably benign Het
Or4a81 A T 2: 89,619,332 (GRCm39) Y121* probably null Het
Or8k53 A C 2: 86,177,763 (GRCm39) S116A probably damaging Het
Parp3 A G 9: 106,350,891 (GRCm39) S329P probably benign Het
Pld3 A T 7: 27,231,741 (GRCm39) N483K probably benign Het
Rbm33 A T 5: 28,557,544 (GRCm39) E252D probably damaging Het
Ryr2 T C 13: 11,609,609 (GRCm39) T4406A probably benign Het
Sgsm3 A G 15: 80,893,063 (GRCm39) D380G possibly damaging Het
Sorl1 G T 9: 41,913,863 (GRCm39) D1355E probably damaging Het
Sptbn1 A G 11: 30,063,984 (GRCm39) S1945P probably damaging Het
Ube2m A T 7: 12,770,396 (GRCm39) F70I probably damaging Het
Ube3b A G 5: 114,546,185 (GRCm39) I664V probably benign Het
Ugt1a7c A G 1: 88,023,378 (GRCm39) E179G possibly damaging Het
Vps50 T C 6: 3,504,939 (GRCm39) probably null Het
Xpo1 T C 11: 23,236,875 (GRCm39) L718P probably damaging Het
Zfp354c A G 11: 50,705,602 (GRCm39) I491T probably benign Het
Other mutations in Amn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Amn APN 12 111,238,227 (GRCm39) missense probably damaging 0.97
IGL02397:Amn APN 12 111,240,913 (GRCm39) missense possibly damaging 0.77
IGL02962:Amn APN 12 111,240,951 (GRCm39) missense probably damaging 1.00
IGL02974:Amn APN 12 111,237,575 (GRCm39) missense probably benign 0.01
IGL02837:Amn UTSW 12 111,238,333 (GRCm39) missense possibly damaging 0.74
R0357:Amn UTSW 12 111,240,575 (GRCm39) critical splice acceptor site probably null
R1986:Amn UTSW 12 111,241,431 (GRCm39) missense probably damaging 1.00
R1993:Amn UTSW 12 111,242,526 (GRCm39) missense probably damaging 1.00
R2355:Amn UTSW 12 111,238,246 (GRCm39) missense probably damaging 0.99
R3924:Amn UTSW 12 111,242,114 (GRCm39) missense possibly damaging 0.71
R3925:Amn UTSW 12 111,242,114 (GRCm39) missense possibly damaging 0.71
R4364:Amn UTSW 12 111,238,196 (GRCm39) missense probably damaging 0.99
R4687:Amn UTSW 12 111,242,502 (GRCm39) missense probably benign 0.35
R6176:Amn UTSW 12 111,240,590 (GRCm39) missense possibly damaging 0.55
R6209:Amn UTSW 12 111,241,845 (GRCm39) missense probably damaging 0.99
R6300:Amn UTSW 12 111,240,623 (GRCm39) missense probably benign 0.16
R6691:Amn UTSW 12 111,241,831 (GRCm39) missense possibly damaging 0.77
R8475:Amn UTSW 12 111,241,819 (GRCm39) missense probably benign 0.02
R8747:Amn UTSW 12 111,241,440 (GRCm39) missense probably damaging 1.00
R9262:Amn UTSW 12 111,237,585 (GRCm39) nonsense probably null
X0025:Amn UTSW 12 111,241,833 (GRCm39) missense probably damaging 1.00
Z1088:Amn UTSW 12 111,242,117 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGGACCTCTTCCTGAAGCAG -3'
(R):5'- TGATTCAGCTCTGAGTCTGC -3'

Sequencing Primer
(F):5'- GGTAAGGAAGCCACACGCC -3'
(R):5'- AGCTCTGAGTCTGCCGTCATAG -3'
Posted On 2019-01-16