Incidental Mutation 'R6528:Shox2'
ID543487
Institutional Source Beutler Lab
Gene Symbol Shox2
Ensembl Gene ENSMUSG00000027833
Gene Nameshort stature homeobox 2
SynonymsPrx3, 6330543G17Rik, Og12x
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.671) question?
Stock #R6528 (G1)
Quality Score68.0074
Status Validated
Chromosome3
Chromosomal Location66971727-66981771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 66981285 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 91 (R91L)
Ref Sequence ENSEMBL: ENSMUSP00000029422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029422]
Predicted Effect probably benign
Transcript: ENSMUST00000029422
AA Change: R91L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029422
Gene: ENSMUSG00000027833
AA Change: R91L

DomainStartEndE-ValueType
low complexity region 57 90 N/A INTRINSIC
HOX 140 202 1.8e-28 SMART
low complexity region 258 273 N/A INTRINSIC
Pfam:OAR 310 327 3.3e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice display incomplete penetrance of embryonic lethality during organogenesis and incomplete clefting of the anterior part of the palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr530 G T 7: 140,373,441 H56Q possibly damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in Shox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Shox2 APN 3 66981441 missense possibly damaging 0.49
IGL00813:Shox2 APN 3 66975444 missense probably damaging 1.00
IGL01534:Shox2 APN 3 66978363 missense probably benign 0.01
IGL01583:Shox2 APN 3 66973771 unclassified probably benign
R0306:Shox2 UTSW 3 66973834 missense probably damaging 0.98
R0374:Shox2 UTSW 3 66973851 missense probably damaging 0.98
R0625:Shox2 UTSW 3 66981544 critical splice donor site probably null
R0774:Shox2 UTSW 3 66973811 missense probably damaging 1.00
R1102:Shox2 UTSW 3 66978295 missense probably damaging 1.00
R1192:Shox2 UTSW 3 66973910 nonsense probably null
R2354:Shox2 UTSW 3 66981489 missense possibly damaging 0.94
R2518:Shox2 UTSW 3 66978359 missense possibly damaging 0.83
R4163:Shox2 UTSW 3 66973771 unclassified probably benign
R4976:Shox2 UTSW 3 66973675 unclassified probably benign
R5423:Shox2 UTSW 3 66973754 unclassified probably benign
R5493:Shox2 UTSW 3 66981463 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCGGTATCTCCCAAAGCTG -3'
(R):5'- AGAAGGAGGCCATCACGTAC -3'

Sequencing Primer
(F):5'- CAGGGCCCTCTGCGATG -3'
(R):5'- GCCATCACGTACCGGGAG -3'
Posted On2019-01-24