Incidental Mutation 'R6671:Gm5591'
ID543515
Institutional Source Beutler Lab
Gene Symbol Gm5591
Ensembl Gene ENSMUSG00000060565
Gene Namepredicted gene 5591
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6671 (G1)
Quality Score64.0073
Status Validated
Chromosome7
Chromosomal Location38518139-38528193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 38520099 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 450 (D450A)
Ref Sequence ENSEMBL: ENSMUSP00000078695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079759
AA Change: D450A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078695
Gene: ENSMUSG00000060565
AA Change: D450A

DomainStartEndE-ValueType
low complexity region 319 330 N/A INTRINSIC
Pfam:DUF4629 437 582 1.2e-59 PFAM
low complexity region 648 660 N/A INTRINSIC
low complexity region 693 704 N/A INTRINSIC
low complexity region 711 723 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Gm5591
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm5591 APN 7 38520414 missense probably benign 0.20
IGL02277:Gm5591 APN 7 38520432 missense probably damaging 0.98
IGL02277:Gm5591 APN 7 38519038 missense possibly damaging 0.92
IGL02503:Gm5591 APN 7 38520009 missense probably damaging 1.00
IGL02897:Gm5591 APN 7 38520042 missense probably damaging 1.00
IGL02899:Gm5591 APN 7 38519418 missense probably damaging 1.00
R1599:Gm5591 UTSW 7 38520370 missense probably benign
R2365:Gm5591 UTSW 7 38519401 missense probably damaging 1.00
R3054:Gm5591 UTSW 7 38520634 missense probably benign 0.35
R4619:Gm5591 UTSW 7 38520648 missense probably benign 0.04
R4722:Gm5591 UTSW 7 38519148 missense probably damaging 1.00
R4779:Gm5591 UTSW 7 38522256 missense probably damaging 0.96
R5079:Gm5591 UTSW 7 38522136 missense probably benign 0.01
R5237:Gm5591 UTSW 7 38522207 missense probably benign 0.31
R5267:Gm5591 UTSW 7 38518914 missense possibly damaging 0.94
R6337:Gm5591 UTSW 7 38521895 missense probably benign 0.00
R6458:Gm5591 UTSW 7 38519035 missense probably damaging 1.00
R6709:Gm5591 UTSW 7 38522075 missense probably benign 0.31
R6874:Gm5591 UTSW 7 38520291 missense probably damaging 0.97
R6917:Gm5591 UTSW 7 38522190 missense probably damaging 0.99
R6993:Gm5591 UTSW 7 38519223 missense probably benign
R7446:Gm5591 UTSW 7 38519509 missense probably benign 0.16
R7519:Gm5591 UTSW 7 38520670 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGACTGCTTAAGCTCCTGTG -3'
(R):5'- GCTGGAGAATGAGACTGGATCC -3'

Sequencing Primer
(F):5'- GGAGTTGTTCTCTGGCCCAC -3'
(R):5'- TGGATCCAGAAACAACTTTGACG -3'
Posted On2019-02-13