Mutagenetix > Incidental Mutation

Incidental Mutation 'R6672:Nup133'

543532

Institutional Source

Beutler Lab

Gene Symbol

Nup133

Ensembl Gene

ENSMUSG00000039509

Gene Name

nucleoporin 133

Synonyms

4832420O05Rik, mermaid

MMRRC Submission

044792-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6672 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124623862-124676004 bp(-) (GRCm39)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 124643020 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000048084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]

AlphaFold

Q8R0G9

Predicted Effect

probably null
Transcript: ENSMUST00000044795

SMART Domains

Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
PDB:1XKS\|A	66	513	N/A	PDB
Pfam:Nucleoporin_C	593	1052	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actmap	C	T	7: 26,903,489 (GRCm39)		probably benign	Het
Adam24	A	G	8: 41,134,572 (GRCm39)	E680G	probably benign	Het
Adam7	T	A	14: 68,742,151 (GRCm39)		probably null	Het
Arid2	C	T	15: 96,260,226 (GRCm39)	T351I	probably benign	Het
Asz1	T	A	6: 18,075,817 (GRCm39)	E252V	possibly damaging	Het
Chrm5	C	T	2: 112,310,141 (GRCm39)	C325Y	probably benign	Het
Cimap1a	A	G	7: 140,428,340 (GRCm39)	S25G	probably benign	Het
Cyp2c65	A	G	19: 39,076,118 (GRCm39)	R357G	probably damaging	Het
Dhx36	A	G	3: 62,402,957 (GRCm39)	V265A	probably damaging	Het
Dhx36	T	A	3: 62,408,300 (GRCm39)	E179D	probably benign	Het
Dip2c	G	A	13: 9,617,866 (GRCm39)		probably null	Het
Dock10	A	T	1: 80,490,248 (GRCm39)	M1958K	probably benign	Het
Dpf1	T	C	7: 29,015,693 (GRCm39)	C357R	probably damaging	Het
Dync1h1	C	T	12: 110,624,568 (GRCm39)	R3703C	probably damaging	Het
Eef1g	A	G	19: 8,944,411 (GRCm39)		probably null	Het
Gnl2	T	C	4: 124,942,186 (GRCm39)	V397A	probably damaging	Het
Gramd2b	A	G	18: 56,565,408 (GRCm39)	E21G	possibly damaging	Het
Grik3	C	A	4: 125,517,309 (GRCm39)	Q51K	probably benign	Het
Hectd2	G	T	19: 36,564,780 (GRCm39)	Q20H	probably damaging	Het
Krtap5-1	A	G	7: 141,850,233 (GRCm39)	C192R	unknown	Het
Lrpap1	A	T	5: 35,256,577 (GRCm39)	M135K	probably benign	Het
Lrrc9	G	A	12: 72,520,710 (GRCm39)	R664H	possibly damaging	Het
Mef2c	T	G	13: 83,800,975 (GRCm39)	V225G	probably damaging	Het
Nlrp9b	T	C	7: 19,753,263 (GRCm39)	L56P	probably damaging	Het
Or12j4	G	A	7: 140,046,648 (GRCm39)	C178Y	probably damaging	Het
Or5ak23	T	A	2: 85,244,948 (GRCm39)	I92L	possibly damaging	Het
Ppp1r3d	T	C	2: 178,055,552 (GRCm39)	E150G	possibly damaging	Het
Smpd1	A	G	7: 105,204,480 (GRCm39)	M120V	probably benign	Het
Zbtb46	A	G	2: 181,053,629 (GRCm39)	L361P	probably benign	Het
Zfp605	A	G	5: 110,275,863 (GRCm39)	H327R	probably damaging	Het

Other mutations in Nup133

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Nup133	APN	8	124,665,822 (GRCm39)	missense	probably damaging	0.98
IGL00507:Nup133	APN	8	124,645,706 (GRCm39)	nonsense	probably null
IGL00585:Nup133	APN	8	124,636,733 (GRCm39)	missense	probably damaging	1.00
IGL00676:Nup133	APN	8	124,633,037 (GRCm39)	intron	probably benign
IGL00966:Nup133	APN	8	124,638,645 (GRCm39)	missense	probably damaging	0.98
IGL01069:Nup133	APN	8	124,657,721 (GRCm39)	nonsense	probably null
IGL01553:Nup133	APN	8	124,642,063 (GRCm39)	missense	possibly damaging	0.58
IGL01669:Nup133	APN	8	124,665,869 (GRCm39)	nonsense	probably null
IGL01730:Nup133	APN	8	124,664,972 (GRCm39)	missense	probably benign	0.00
IGL01996:Nup133	APN	8	124,673,334 (GRCm39)	missense	probably benign	0.00
IGL02332:Nup133	APN	8	124,634,571 (GRCm39)	missense	probably damaging	1.00
IGL02552:Nup133	APN	8	124,655,994 (GRCm39)	missense	possibly damaging	0.75
IGL02956:Nup133	APN	8	124,675,822 (GRCm39)	missense	probably benign	0.00
IGL03009:Nup133	APN	8	124,660,239 (GRCm39)	missense	possibly damaging	0.46
IGL03036:Nup133	APN	8	124,673,333 (GRCm39)	missense	probably benign	0.11
Cadenza	UTSW	8	124,638,627 (GRCm39)	frame shift	probably null
Gangen	UTSW	8	124,643,021 (GRCm39)	critical splice donor site	probably null
hochzeit	UTSW	8	124,656,082 (GRCm39)	missense	probably benign	0.00
low_road	UTSW	8	124,631,318 (GRCm39)	missense	probably damaging	1.00
Pathway	UTSW	8	124,644,185 (GRCm39)	missense	possibly damaging	0.82
Slant	UTSW	8	124,643,020 (GRCm39)	splice site	probably null
R0010:Nup133	UTSW	8	124,631,318 (GRCm39)	missense	probably damaging	1.00
R0010:Nup133	UTSW	8	124,631,318 (GRCm39)	missense	probably damaging	1.00
R0139:Nup133	UTSW	8	124,656,082 (GRCm39)	missense	probably benign	0.00
R0344:Nup133	UTSW	8	124,644,185 (GRCm39)	missense	possibly damaging	0.82
R0730:Nup133	UTSW	8	124,675,747 (GRCm39)	missense	probably benign	0.00
R1301:Nup133	UTSW	8	124,644,156 (GRCm39)	intron	probably benign
R1453:Nup133	UTSW	8	124,642,114 (GRCm39)	missense	probably benign	0.00
R1570:Nup133	UTSW	8	124,675,915 (GRCm39)	start codon destroyed	possibly damaging	0.82
R1607:Nup133	UTSW	8	124,675,774 (GRCm39)	missense	probably benign	0.02
R1773:Nup133	UTSW	8	124,657,722 (GRCm39)	nonsense	probably null
R1992:Nup133	UTSW	8	124,632,960 (GRCm39)	missense	possibly damaging	0.80
R2062:Nup133	UTSW	8	124,641,314 (GRCm39)	missense	probably damaging	1.00
R2065:Nup133	UTSW	8	124,641,314 (GRCm39)	missense	probably damaging	1.00
R2066:Nup133	UTSW	8	124,641,314 (GRCm39)	missense	probably damaging	1.00
R2068:Nup133	UTSW	8	124,641,314 (GRCm39)	missense	probably damaging	1.00
R4397:Nup133	UTSW	8	124,671,040 (GRCm39)	missense	probably benign	0.04
R4683:Nup133	UTSW	8	124,657,721 (GRCm39)	nonsense	probably null
R4771:Nup133	UTSW	8	124,656,137 (GRCm39)	missense	probably damaging	1.00
R4910:Nup133	UTSW	8	124,653,870 (GRCm39)	missense	possibly damaging	0.91
R4911:Nup133	UTSW	8	124,653,870 (GRCm39)	missense	possibly damaging	0.91
R4968:Nup133	UTSW	8	124,641,935 (GRCm39)	missense	probably benign	0.07
R5411:Nup133	UTSW	8	124,653,945 (GRCm39)	missense	probably benign
R5470:Nup133	UTSW	8	124,657,705 (GRCm39)	missense	probably benign	0.00
R5664:Nup133	UTSW	8	124,633,020 (GRCm39)	missense	probably benign	0.01
R5907:Nup133	UTSW	8	124,643,038 (GRCm39)	missense	possibly damaging	0.90
R6003:Nup133	UTSW	8	124,665,031 (GRCm39)	missense	probably damaging	0.98
R6059:Nup133	UTSW	8	124,641,335 (GRCm39)	missense	probably damaging	1.00
R6219:Nup133	UTSW	8	124,663,612 (GRCm39)	missense	possibly damaging	0.90
R6292:Nup133	UTSW	8	124,644,176 (GRCm39)	missense	probably benign	0.01
R6737:Nup133	UTSW	8	124,633,030 (GRCm39)	missense	probably damaging	0.99
R6763:Nup133	UTSW	8	124,671,017 (GRCm39)	missense	possibly damaging	0.95
R6870:Nup133	UTSW	8	124,626,246 (GRCm39)	missense	probably benign	0.08
R6975:Nup133	UTSW	8	124,642,057 (GRCm39)	missense	probably damaging	0.99
R7101:Nup133	UTSW	8	124,632,966 (GRCm39)	missense	possibly damaging	0.89
R7114:Nup133	UTSW	8	124,642,112 (GRCm39)	missense	probably benign	0.00
R7271:Nup133	UTSW	8	124,649,153 (GRCm39)	missense	probably benign	0.34
R7501:Nup133	UTSW	8	124,649,153 (GRCm39)	missense	probably benign	0.34
R8054:Nup133	UTSW	8	124,675,956 (GRCm39)	intron	probably benign
R8397:Nup133	UTSW	8	124,649,156 (GRCm39)	missense	probably benign	0.17
R8703:Nup133	UTSW	8	124,643,021 (GRCm39)	critical splice donor site	probably null
R8811:Nup133	UTSW	8	124,638,627 (GRCm39)	frame shift	probably null
R8813:Nup133	UTSW	8	124,638,627 (GRCm39)	frame shift	probably null
R8952:Nup133	UTSW	8	124,634,500 (GRCm39)	missense	probably damaging	1.00
R9116:Nup133	UTSW	8	124,660,155 (GRCm39)	missense	probably benign	0.00
R9340:Nup133	UTSW	8	124,664,881 (GRCm39)	missense	probably benign	0.38
X0023:Nup133	UTSW	8	124,636,727 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAGGTGCATCATAAGTCCAC -3'
(R):5'- CCCTTAGGCACAGTGTATGAC -3'

Sequencing Primer
(F):5'- ATCTCTGAGATTGAGGCCAGC -3'
(R):5'- CCTTAGGCACAGTGTATGACAGAAAG -3'

Posted On

2019-02-18