Incidental Mutation 'R6727:Tgfb1'
ID 543587
Institutional Source Beutler Lab
Gene Symbol Tgfb1
Ensembl Gene ENSMUSG00000002603
Gene Name transforming growth factor, beta 1
Synonyms Tgfb, TGF-beta1, TGF-beta 1, Tgfb-1, TGFbeta1
MMRRC Submission 044845-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.443) question?
Stock # R6727 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 25386427-25404502 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 25388587 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002678] [ENSMUST00000108403] [ENSMUST00000169009] [ENSMUST00000205658]
AlphaFold P04202
Predicted Effect probably benign
Transcript: ENSMUST00000002678
SMART Domains Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:TGFb_propeptide 29 261 3.2e-41 PFAM
TGFB 293 390 1.95e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108403
SMART Domains Protein: ENSMUSP00000104040
Gene: ENSMUSG00000063439

DomainStartEndE-ValueType
Pfam:B9-C2 4 164 5.1e-64 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000169009
AA Change: Q41L
Predicted Effect probably benign
Transcript: ENSMUST00000205658
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. Mice lacking a functional copy of this gene develop severe multifocal inflammatory disease, yolk sac defects and colon cancer. [provided by RefSeq, Aug 2016]
PHENOTYPE: Many homozygous null mutants die in utero by day 10.5 from yolk sac vasculature and hemopoietic defects. Survivors die by 5 weeks with wasting syndrome, excess inflammatory response and tissue necrosis. On BALB/c, mice develop necroinflammatory hepatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,354,434 (GRCm39) probably benign Het
4930563M21Rik C T 9: 55,896,760 (GRCm39) V283I possibly damaging Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Allc T A 12: 28,607,388 (GRCm39) H288L probably damaging Het
Atg16l1 T C 1: 87,702,576 (GRCm39) I279T possibly damaging Het
Atp6v1b1 A G 6: 83,728,857 (GRCm39) probably benign Het
Barhl1 G A 2: 28,805,495 (GRCm39) P66L probably benign Het
Brd8dc T A 18: 34,713,894 (GRCm39) M244L probably benign Het
Cfap58 A T 19: 47,943,856 (GRCm39) D352V probably benign Het
Cyp3a44 T A 5: 145,731,781 (GRCm39) K122* probably null Het
Dnai1 G T 4: 41,625,308 (GRCm39) R424L probably benign Het
Dync1li2 G T 8: 105,167,167 (GRCm39) H79Q probably damaging Het
Fem1b A G 9: 62,704,015 (GRCm39) V415A possibly damaging Het
Fgb C T 3: 82,954,094 (GRCm39) S48N possibly damaging Het
Gm5624 T C 14: 44,799,332 (GRCm39) D31G possibly damaging Het
Gzmn T A 14: 56,403,432 (GRCm39) I226F probably damaging Het
H2-T5 A T 17: 36,476,622 (GRCm39) V284E probably damaging Het
Il31ra T C 13: 112,683,902 (GRCm39) S184G probably damaging Het
Insrr C T 3: 87,720,873 (GRCm39) R1044C probably damaging Het
Kcnj15 A G 16: 95,097,193 (GRCm39) S272G probably damaging Het
Kcnk16 C T 14: 20,312,997 (GRCm39) A106T probably benign Het
Kmt2b A G 7: 30,283,984 (GRCm39) V876A probably damaging Het
Large2 G T 2: 92,201,215 (GRCm39) probably benign Het
Maml2 A T 9: 13,532,847 (GRCm39) probably benign Het
Me1 A G 9: 86,464,851 (GRCm39) L533P possibly damaging Het
Muc16 A G 9: 18,477,986 (GRCm39) probably null Het
Nova2 C A 7: 18,692,419 (GRCm39) T516K probably damaging Het
Or1l4 T A 2: 37,092,118 (GRCm39) N288K probably damaging Het
Or56b1 T C 7: 104,285,094 (GRCm39) I71T probably damaging Het
Otogl G A 10: 107,612,978 (GRCm39) silent Het
Ppp2r1a T A 17: 21,176,087 (GRCm39) V103E probably benign Het
Prl3d3 G A 13: 27,341,147 (GRCm39) probably null Het
Rhbdf1 G T 11: 32,164,042 (GRCm39) A288E possibly damaging Het
Rnf213 T C 11: 119,321,147 (GRCm39) S1202P possibly damaging Het
Slc25a17 A G 15: 81,222,154 (GRCm39) V106A probably benign Het
Slc4a4 T G 5: 89,318,624 (GRCm39) S640A probably benign Het
Smc4 T A 3: 68,924,105 (GRCm39) Y298N probably damaging Het
Tek G T 4: 94,741,732 (GRCm39) G830* probably null Het
Themis T C 10: 28,657,903 (GRCm39) I157T probably damaging Het
Trmt12 A G 15: 58,744,514 (GRCm39) probably benign Het
Trrap T C 5: 144,793,760 (GRCm39) W3654R probably damaging Het
Tspan3 C T 9: 56,054,724 (GRCm39) G108S probably damaging Het
Ugt1a10 T A 1: 87,983,979 (GRCm39) probably null Het
Vps13b A G 15: 35,770,829 (GRCm39) K2091E probably benign Het
Wdr62 A T 7: 29,971,045 (GRCm39) V184D probably damaging Het
Zfp958 C A 8: 4,678,247 (GRCm39) Q90K probably benign Het
Other mutations in Tgfb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tgfb1 APN 7 25,387,442 (GRCm39) missense probably damaging 1.00
IGL03028:Tgfb1 APN 7 25,403,621 (GRCm39) missense probably damaging 1.00
PIT4377001:Tgfb1 UTSW 7 25,396,343 (GRCm39) missense probably benign
R0004:Tgfb1 UTSW 7 25,391,791 (GRCm39) splice site probably benign
R0048:Tgfb1 UTSW 7 25,393,779 (GRCm39) splice site probably benign
R0048:Tgfb1 UTSW 7 25,393,779 (GRCm39) splice site probably benign
R0470:Tgfb1 UTSW 7 25,387,355 (GRCm39) unclassified probably benign
R1872:Tgfb1 UTSW 7 25,391,891 (GRCm39) missense probably damaging 1.00
R2178:Tgfb1 UTSW 7 25,404,234 (GRCm39) missense probably damaging 1.00
R4581:Tgfb1 UTSW 7 25,396,655 (GRCm39) missense possibly damaging 0.81
R5484:Tgfb1 UTSW 7 25,387,574 (GRCm39) missense probably benign 0.00
R5663:Tgfb1 UTSW 7 25,393,706 (GRCm39) missense possibly damaging 0.93
R5781:Tgfb1 UTSW 7 25,396,385 (GRCm39) missense probably benign 0.00
R6548:Tgfb1 UTSW 7 25,396,350 (GRCm39) missense probably benign 0.01
R7203:Tgfb1 UTSW 7 25,391,964 (GRCm39) critical splice donor site probably null
R7449:Tgfb1 UTSW 7 25,404,263 (GRCm39) missense probably damaging 1.00
R7654:Tgfb1 UTSW 7 25,387,120 (GRCm39) unclassified probably benign
R8257:Tgfb1 UTSW 7 25,396,373 (GRCm39) missense probably damaging 0.97
R9124:Tgfb1 UTSW 7 25,388,580 (GRCm39) nonsense probably null
R9418:Tgfb1 UTSW 7 25,391,952 (GRCm39) missense probably damaging 1.00
Z1177:Tgfb1 UTSW 7 25,387,633 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAGCGAGTCCTCAAGAAATC -3'
(R):5'- ACACCTAAAGTTCCCCGGTC -3'

Sequencing Primer
(F):5'- CCTCAAGAAATCTAGAATACTGGGTC -3'
(R):5'- TCACACACGACGCTTGG -3'
Posted On 2019-03-18