Incidental Mutation 'R6665:Rab32'
ID543598
Institutional Source Beutler Lab
Gene Symbol Rab32
Ensembl Gene ENSMUSG00000019832
Gene NameRAB32, member RAS oncogene family
Synonyms2810011A17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_026405; MGI: 1915094

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6665 (G1)
Quality Score64.0073
Status Validated
Chromosome10
Chromosomal Location10545002-10558265 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 10558102 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019974] [ENSMUST00000220018]
Predicted Effect probably benign
Transcript: ENSMUST00000019974
SMART Domains Protein: ENSMUSP00000019974
Gene: ENSMUSG00000019832

DomainStartEndE-ValueType
RAB 24 193 3.44e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220018
Meta Mutation Damage Score 0.1016 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene anchors the type II regulatory subunit of protein kinase A to the mitochondrion and aids in mitochondrial fission. The encoded protein also appears to be involved in autophagy and melanosome secretion. Variations in this gene may be linked to leprosy. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,904,479 probably null Het
Adamts16 T G 13: 70,779,570 K517Q probably damaging Het
Atp9b A C 18: 80,917,735 V87G probably benign Het
Avil A G 10: 127,020,525 K808E probably damaging Het
Bin2 T C 15: 100,656,795 E49G probably damaging Het
Ccdc146 T C 5: 21,303,094 Y652C probably damaging Het
Cd6 T C 19: 10,791,003 N541D probably benign Het
Col28a1 A G 6: 8,062,277 V671A probably benign Het
Dock6 C T 9: 21,839,912 C355Y probably damaging Het
Dsc2 A G 18: 20,050,148 F71S probably damaging Het
Dusp8 G A 7: 142,090,105 P24S probably damaging Het
Dysf A G 6: 84,130,116 Y1151C probably benign Het
Fam160b2 A T 14: 70,585,638 L659Q probably damaging Het
Frem2 T C 3: 53,654,656 Y810C probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hexb T C 13: 97,179,385 N380D probably benign Het
Ice1 T C 13: 70,603,473 E1498G possibly damaging Het
Lrif1 T A 3: 106,735,343 probably null Het
Myo9a G T 9: 59,871,872 G1637V probably benign Het
Myod1 A T 7: 46,376,857 H62L probably damaging Het
Myoz3 A C 18: 60,576,423 L222R probably damaging Het
Naca T A 10: 128,048,358 N2180K probably damaging Het
Olfr809 T C 10: 129,776,247 F111S probably damaging Het
Pik3cb A G 9: 99,073,649 V405A probably benign Het
Prkdc T C 16: 15,786,050 probably null Het
Serpinb10 A C 1: 107,546,867 N253T possibly damaging Het
Slc13a5 C T 11: 72,260,360 V131I probably damaging Het
Slc25a40 A G 5: 8,452,788 N290S probably benign Het
Slc6a6 T C 6: 91,726,039 V131A probably benign Het
Spef2 A T 15: 9,600,518 probably null Het
Stxbp2 A G 8: 3,641,998 M547V probably benign Het
Tmem247 A T 17: 86,918,570 Q146L probably benign Het
Vmn2r67 T C 7: 85,136,692 I702V probably benign Het
Zmynd15 T C 11: 70,464,810 S436P probably benign Het
Other mutations in Rab32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Rab32 APN 10 10550812 missense probably benign 0.07
IGL01061:Rab32 APN 10 10557874 missense probably damaging 0.99
IGL01071:Rab32 APN 10 10557847 missense probably damaging 1.00
IGL02193:Rab32 APN 10 10546455 splice site probably benign
IGL02814:Rab32 APN 10 10546427 missense probably benign
IGL03233:Rab32 APN 10 10546313 nonsense probably null
A5278:Rab32 UTSW 10 10557973 missense possibly damaging 0.94
R0135:Rab32 UTSW 10 10550840 missense probably damaging 1.00
R0514:Rab32 UTSW 10 10550896 missense probably damaging 1.00
R0826:Rab32 UTSW 10 10550867 missense possibly damaging 0.95
R1406:Rab32 UTSW 10 10550893 missense probably damaging 1.00
R1406:Rab32 UTSW 10 10550893 missense probably damaging 1.00
R2045:Rab32 UTSW 10 10550833 missense probably damaging 1.00
R4701:Rab32 UTSW 10 10550854 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTTGAGAACTTTGAGGGCG -3'
(R):5'- ACTTGACATCATGGACCAGCC -3'

Sequencing Primer
(F):5'- AAGTCCACGCCAATGGTG -3'
(R):5'- TTGTCTAAGGCCAGCAGGG -3'
Posted On2019-03-22