Incidental Mutation 'R6765:Sclt1'
ID543604
Institutional Source Beutler Lab
Gene Symbol Sclt1
Ensembl Gene ENSMUSG00000059834
Gene Namesodium channel and clathrin linker 1
Synonyms2610207F23Rik, 4931421F20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R6765 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location41626720-41742514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41730902 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 39 (R39G)
Ref Sequence ENSEMBL: ENSMUSP00000117608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026866] [ENSMUST00000146125] [ENSMUST00000148769]
Predicted Effect silent
Transcript: ENSMUST00000026866
SMART Domains Protein: ENSMUSP00000026866
Gene: ENSMUSG00000059834

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
internal_repeat_1 166 179 6.29e-5 PROSPERO
coiled coil region 372 543 N/A INTRINSIC
internal_repeat_1 555 568 6.29e-5 PROSPERO
coiled coil region 571 675 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146125
AA Change: R39G
Predicted Effect silent
Transcript: ENSMUST00000148769
SMART Domains Protein: ENSMUSP00000123392
Gene: ENSMUSG00000059834

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
coiled coil region 178 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous knockout causes polycystic kidney disease, impaired postnatal weight gain and premature death (before 1 month of age). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,686,429 G42W probably damaging Het
3110002H16Rik A G 18: 12,176,146 N92D possibly damaging Het
Adamtsl3 C A 7: 82,567,024 D878E possibly damaging Het
Adipor2 A C 6: 119,357,242 F336V possibly damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aoc1 A G 6: 48,905,937 N249S probably benign Het
Ap1b1 T A 11: 5,019,427 L261Q probably damaging Het
Ap3b1 T A 13: 94,462,509 D530E probably benign Het
Arid4b T A 13: 14,187,315 M788K possibly damaging Het
Atp2c2 A T 8: 119,753,017 I762F probably damaging Het
Bhlhe23 C A 2: 180,776,343 R134L probably damaging Het
Cacna2d3 T C 14: 29,055,977 D687G probably damaging Het
Ccdc136 G A 6: 29,405,941 M95I probably benign Het
Cdk12 T A 11: 98,224,529 I832N unknown Het
Clcn2 A C 16: 20,707,668 probably null Het
Csrnp2 C T 15: 100,482,693 R239Q probably damaging Het
Dhrs13 T A 11: 78,037,139 D270E probably benign Het
Dlgap2 G A 8: 14,743,284 G426D probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam120a A G 13: 48,891,964 Y799H probably damaging Het
Fam160b1 A G 19: 57,378,745 D240G probably benign Het
Farp1 G A 14: 121,222,654 V112I probably benign Het
Fsip2 A G 2: 82,986,432 I4170V probably benign Het
Gm12185 A G 11: 48,915,704 V220A probably benign Het
Gpr37l1 T C 1: 135,167,122 Y128C probably damaging Het
Gsto2 A T 19: 47,871,788 R7* probably null Het
Itih3 C T 14: 30,909,473 G822D probably benign Het
Kcnu1 A T 8: 25,913,645 D728V probably damaging Het
Lnpep G A 17: 17,530,496 T976I probably damaging Het
Map1b A C 13: 99,425,941 H2420Q unknown Het
Mc1r A G 8: 123,407,696 K63E probably damaging Het
Mpped1 G A 15: 83,836,383 V15M probably damaging Het
Ncor1 T C 11: 62,373,446 T103A probably benign Het
Nhsl1 A T 10: 18,531,314 T1399S probably benign Het
Nlrc5 C T 8: 94,490,368 T995M probably benign Het
Nrbp1 G A 5: 31,245,846 probably null Het
Olfr1065 T C 2: 86,445,236 T249A probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr979 A C 9: 40,001,197 F10C probably damaging Het
Pcdhb13 T C 18: 37,443,610 L347P probably damaging Het
Pkhd1 T C 1: 20,058,339 T4047A probably benign Het
Prrt2 T A 7: 127,019,597 D232V probably damaging Het
Psmd5 A C 2: 34,856,533 M344R probably benign Het
Pwp1 G A 10: 85,884,533 E345K probably damaging Het
Qsox1 A G 1: 155,791,105 Y213H probably benign Het
Syne1 A T 10: 5,143,285 probably null Het
Tmem163 G T 1: 127,551,341 A147E probably damaging Het
Trav13n-4 A T 14: 53,364,100 M109L probably benign Het
Trp53bp1 T C 2: 121,209,309 E1283G probably damaging Het
Trpm6 T A 19: 18,877,765 D1929E probably damaging Het
Upb1 A T 10: 75,438,144 D335V probably damaging Het
Vps26b T C 9: 27,012,808 E213G probably damaging Het
Vwc2 C T 11: 11,154,215 T249I probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zan A G 5: 137,393,147 C4692R unknown Het
Zfp106 T C 2: 120,539,454 E29G probably damaging Het
Zfp551 G A 7: 12,416,840 A214V possibly damaging Het
Zfp981 T A 4: 146,537,906 H429Q probably benign Het
Other mutations in Sclt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Sclt1 APN 3 41741991 unclassified probably benign
IGL01106:Sclt1 APN 3 41675319 splice site probably benign
IGL01368:Sclt1 APN 3 41711175 missense probably damaging 0.96
IGL02001:Sclt1 APN 3 41681721 missense possibly damaging 0.63
IGL02897:Sclt1 APN 3 41675387 missense probably benign 0.01
IGL03066:Sclt1 APN 3 41717843 missense probably benign 0.00
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0172:Sclt1 UTSW 3 41717787 missense possibly damaging 0.84
R0359:Sclt1 UTSW 3 41661570 critical splice donor site probably null
R1281:Sclt1 UTSW 3 41647620 missense probably benign 0.01
R1831:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1832:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1833:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R2027:Sclt1 UTSW 3 41730888 missense probably benign 0.00
R4578:Sclt1 UTSW 3 41671465 nonsense probably null
R5502:Sclt1 UTSW 3 41657275 missense probably benign 0.28
R5558:Sclt1 UTSW 3 41661590 missense probably benign 0.14
R5601:Sclt1 UTSW 3 41730919 missense probably benign
R5710:Sclt1 UTSW 3 41663963 nonsense probably null
R6041:Sclt1 UTSW 3 41627177 missense probably damaging 0.99
R6274:Sclt1 UTSW 3 41629516 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGAACAGGCAAGATTATCCTCC -3'
(R):5'- CGCATGCAGCCTTGTATTGC -3'

Sequencing Primer
(F):5'- GGCAAGATTATCCTCCATTATAATCC -3'
(R):5'- GCAGCCTTGTATTGCTACAGAAC -3'
Posted On2019-03-29