Incidental Mutation 'R6829:Pgc'
ID 543641
Institutional Source Beutler Lab
Gene Symbol Pgc
Ensembl Gene ENSMUSG00000023987
Gene Name progastricsin (pepsinogen C)
Synonyms Upg-1, 2210410L06Rik, Upg1
MMRRC Submission 044939-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6829 (G1)
Quality Score 75.0075
Status Validated
Chromosome 17
Chromosomal Location 48037767-48045403 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 48043706 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024782] [ENSMUST00000086932] [ENSMUST00000126258] [ENSMUST00000144955]
AlphaFold Q9D7R7
Predicted Effect probably null
Transcript: ENSMUST00000024782
SMART Domains Protein: ENSMUSP00000024782
Gene: ENSMUSG00000023987

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 2.1e-17 PFAM
Pfam:Asp 75 391 6.3e-118 PFAM
Pfam:TAXi_N 76 232 7.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086932
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126258
Predicted Effect probably benign
Transcript: ENSMUST00000144955
SMART Domains Protein: ENSMUSP00000123459
Gene: ENSMUSG00000023987

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 1.5e-18 PFAM
Pfam:Asp 63 143 1.4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 A T 14: 66,265,446 (GRCm39) probably null Het
Adamts5 A T 16: 85,666,959 (GRCm39) M511K possibly damaging Het
Adcy9 A G 16: 4,125,018 (GRCm39) probably null Het
Cast T C 13: 74,876,463 (GRCm39) E113G possibly damaging Het
Ccdc198 A G 14: 49,464,025 (GRCm39) *295Q probably null Het
Dcaf1 T A 9: 106,715,803 (GRCm39) S307T probably damaging Het
Dmxl1 C T 18: 50,054,091 (GRCm39) P2566S probably damaging Het
Elac2 A G 11: 64,880,190 (GRCm39) E111G probably benign Het
Fbxw4 A G 19: 45,624,813 (GRCm39) F57S possibly damaging Het
Gm17655 T G 5: 110,194,792 (GRCm39) H330P probably damaging Het
Gm2a T C 11: 54,994,576 (GRCm39) probably null Het
Gon4l T A 3: 88,787,413 (GRCm39) D600E possibly damaging Het
Gsg1l2 T C 11: 67,665,684 (GRCm39) I84T possibly damaging Het
Igsf9 A G 1: 172,323,241 (GRCm39) R652G probably benign Het
Il17rd C T 14: 26,809,379 (GRCm39) R112* probably null Het
Jph1 C A 1: 17,074,647 (GRCm39) R457L probably damaging Het
Khdrbs3 T C 15: 68,964,810 (GRCm39) V249A possibly damaging Het
Mocs2 A G 13: 114,955,980 (GRCm39) S43G probably benign Het
Myom2 T A 8: 15,172,643 (GRCm39) L1190* probably null Het
Or2w1 T A 13: 21,317,023 (GRCm39) I26N possibly damaging Het
Or4f62 G C 2: 111,986,139 (GRCm39) probably benign Het
Or5ac16 A G 16: 59,021,898 (GRCm39) V297A probably damaging Het
Or8k33 A T 2: 86,383,613 (GRCm39) L285* probably null Het
Plch1 T G 3: 63,604,939 (GRCm39) D1655A probably damaging Het
Pnliprp2 G A 19: 58,748,305 (GRCm39) G29R probably benign Het
Polg A G 7: 79,109,857 (GRCm39) V382A probably benign Het
Rb1cc1 T C 1: 6,319,488 (GRCm39) I969T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sdf2l1 C G 16: 16,950,158 (GRCm39) R6P probably benign Het
Sema7a A G 9: 57,868,181 (GRCm39) E538G probably benign Het
Slc2a2 C T 3: 28,781,590 (GRCm39) Q513* probably null Het
Slc4a8 A G 15: 100,698,419 (GRCm39) Y636C probably damaging Het
Tasor A G 14: 27,164,438 (GRCm39) D248G possibly damaging Het
Trpm5 A G 7: 142,623,166 (GRCm39) probably benign Het
Vmn1r14 T C 6: 57,210,536 (GRCm39) L38P probably benign Het
Washc4 T C 10: 83,396,380 (GRCm39) S397P probably damaging Het
Wfdc3 C T 2: 164,576,178 (GRCm39) G38R possibly damaging Het
Zan A G 5: 137,414,540 (GRCm39) probably benign Het
Zfhx3 C T 8: 109,676,915 (GRCm39) T2655M probably damaging Het
Other mutations in Pgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Pgc APN 17 48,041,591 (GRCm39) missense probably benign 0.09
IGL01410:Pgc APN 17 48,045,165 (GRCm39) missense probably damaging 0.98
IGL01647:Pgc APN 17 48,043,329 (GRCm39) missense probably damaging 1.00
IGL02141:Pgc APN 17 48,037,856 (GRCm39) missense probably damaging 1.00
IGL02719:Pgc APN 17 48,039,792 (GRCm39) missense probably damaging 0.98
PIT4469001:Pgc UTSW 17 48,039,680 (GRCm39) nonsense probably null
R0736:Pgc UTSW 17 48,039,705 (GRCm39) missense probably damaging 1.00
R1118:Pgc UTSW 17 48,039,828 (GRCm39) critical splice donor site probably null
R1669:Pgc UTSW 17 48,044,715 (GRCm39) missense probably damaging 1.00
R2162:Pgc UTSW 17 48,040,236 (GRCm39) missense probably null 0.96
R3831:Pgc UTSW 17 48,040,236 (GRCm39) missense probably null 0.96
R3833:Pgc UTSW 17 48,040,236 (GRCm39) missense probably null 0.96
R4454:Pgc UTSW 17 48,043,335 (GRCm39) missense probably benign 0.00
R4908:Pgc UTSW 17 48,039,819 (GRCm39) missense probably damaging 0.96
R5544:Pgc UTSW 17 48,043,429 (GRCm39) missense probably benign 0.00
R7042:Pgc UTSW 17 48,044,745 (GRCm39) missense probably benign 0.00
R7508:Pgc UTSW 17 48,045,111 (GRCm39) missense probably benign 0.00
R8022:Pgc UTSW 17 48,039,701 (GRCm39) missense probably benign 0.00
R9028:Pgc UTSW 17 48,043,983 (GRCm39) missense possibly damaging 0.51
R9074:Pgc UTSW 17 48,043,351 (GRCm39) missense probably damaging 0.98
Z1176:Pgc UTSW 17 48,039,793 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCACCTATGCAGCAGTCTG -3'
(R):5'- TCTACAATGCCTTGGCAGC -3'

Sequencing Primer
(F):5'- TATGCAGCAGTCTGGCAGC -3'
(R):5'- CCTGGTTGCCAATAAGGAAGCTG -3'
Posted On 2019-04-17