Incidental Mutation 'R6781:Arhgef40'
ID543667
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene NameRho guanine nucleotide exchange factor (GEF) 40
SynonymsE130112L23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R6781 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location51984719-52006251 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 51997897 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208]
Predicted Effect probably benign
Transcript: ENSMUST00000093813
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100639
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182061
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182217
Predicted Effect probably benign
Transcript: ENSMUST00000182412
Predicted Effect probably benign
Transcript: ENSMUST00000182667
Predicted Effect probably benign
Transcript: ENSMUST00000182760
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182905
AA Change: Y1177S
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562
AA Change: Y1177S

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182909
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Meta Mutation Damage Score 0.0536 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,374,406 I259N possibly damaging Het
Acot12 G T 13: 91,784,412 probably null Het
AI182371 G T 2: 35,084,705 probably benign Het
Amigo3 T C 9: 108,053,963 L195P probably damaging Het
Aox4 A T 1: 58,245,109 D556V probably benign Het
Asb15 T C 6: 24,558,675 V63A probably benign Het
Bicd1 T C 6: 149,513,166 I459T possibly damaging Het
Bub1 C A 2: 127,807,857 G694W probably damaging Het
C4b A T 17: 34,742,954 I106N probably damaging Het
Clca4b T C 3: 144,922,801 I382V probably benign Het
Cntnap5a A C 1: 116,292,397 S646R probably benign Het
Cntnap5c C T 17: 58,138,653 Q563* probably null Het
Cpn1 A G 19: 43,980,904 F107L possibly damaging Het
Csrnp3 T A 2: 66,022,271 C336S probably benign Het
Defa3 T A 8: 21,288,261 M87K probably benign Het
Dmbt1 T C 7: 131,046,561 F274L probably benign Het
Dnah8 TTA TTATA 17: 30,765,724 probably null Het
Dnase2b T C 3: 146,582,371 H323R probably benign Het
Fam83e A T 7: 45,722,147 probably benign Het
Fbn1 T C 2: 125,317,038 N2269S probably damaging Het
Foxa1 A T 12: 57,543,257 M59K possibly damaging Het
Fpr3 T C 17: 17,970,716 V83A probably benign Het
Frmd6 A G 12: 70,899,643 D615G possibly damaging Het
Gfra3 T C 18: 34,711,322 K55R possibly damaging Het
Gm5414 A T 15: 101,625,661 S296T possibly damaging Het
Gtf3c1 T A 7: 125,659,197 K1234* probably null Het
Hltf T A 3: 20,098,166 Y609N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift74 A G 4: 94,627,302 D152G probably damaging Het
Kcnk6 T C 7: 29,225,055 Y308C probably damaging Het
Klhl29 A G 12: 5,091,347 S546P probably damaging Het
Map7d1 AGGGCAGCC AGGGCAGCCGGGCAGCC 4: 126,240,751 probably null Het
Meis2 T A 2: 116,049,155 H228L probably benign Het
Mfsd10 A T 5: 34,634,509 M344K possibly damaging Het
Mrps33 T C 6: 39,805,823 probably benign Het
Olfr1198 A T 2: 88,746,830 N19K probably benign Het
Olfr437 A G 6: 43,167,388 E110G probably damaging Het
Pik3cb T C 9: 99,040,992 T996A possibly damaging Het
Plekha7 A G 7: 116,157,855 probably null Het
Ppp1cb A G 5: 32,480,762 Y86C probably damaging Het
Sass6 T G 3: 116,595,124 probably benign Het
Slc6a15 A T 10: 103,395,067 I218F probably damaging Het
St5 T C 7: 109,525,304 D1110G possibly damaging Het
Tcf23 C T 5: 30,968,960 P61L probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zc3h6 T C 2: 129,015,421 F620S probably damaging Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52004907 unclassified probably benign
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 51989930 missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 51990171 missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 51994338 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 51997032 missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 51987496 missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 51990090 missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGAGTACGTAACCACC -3'
(R):5'- AGCTCTAAATGCCTTCGCCC -3'

Sequencing Primer
(F):5'- TAACGCCTGAGCTTCGATG -3'
(R):5'- TCCCCACTAACCCAGGAGGATAAG -3'
Posted On2019-04-30