Incidental Mutation 'R6973:Tnni3'
ID543711
Institutional Source Beutler Lab
Gene Symbol Tnni3
Ensembl Gene ENSMUSG00000035458
Gene Nametroponin I, cardiac 3
SynonymscTnI, cardiac troponin I, Tn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6973 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4518305-4524229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4518417 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 196 (I196T)
Ref Sequence ENSEMBL: ENSMUSP00000096458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071798] [ENSMUST00000094897] [ENSMUST00000098859] [ENSMUST00000108587] [ENSMUST00000140424] [ENSMUST00000154913] [ENSMUST00000163538] [ENSMUST00000163560] [ENSMUST00000163710] [ENSMUST00000163722] [ENSMUST00000166161] [ENSMUST00000166268] [ENSMUST00000166959] [ENSMUST00000178163] [ENSMUST00000209148]
PDB Structure
Solution structure of the bisphosphorylated cardiac specific N-extension of cardiac troponin I [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000071798
SMART Domains Protein: ENSMUSP00000071704
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094897
SMART Domains Protein: ENSMUSP00000092498
Gene: ENSMUSG00000055809

DomainStartEndE-ValueType
Pfam:DUF4470 16 122 1.3e-27 PFAM
Pfam:DUF4471 154 436 5.3e-104 PFAM
internal_repeat_1 467 512 1.63e-5 PROSPERO
internal_repeat_1 525 568 1.63e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000098859
AA Change: I196T

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096458
Gene: ENSMUSG00000035458
AA Change: I196T

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1e-10 PFAM
Pfam:Troponin 47 178 3.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108587
SMART Domains Protein: ENSMUSP00000104228
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 205 3e-36 PFAM
Pfam:Troponin 197 260 4.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140424
SMART Domains Protein: ENSMUSP00000115015
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1.1e-14 PFAM
Pfam:Troponin 47 125 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154913
SMART Domains Protein: ENSMUSP00000122916
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 9e-15 PFAM
Pfam:Troponin 47 112 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163538
SMART Domains Protein: ENSMUSP00000127964
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 160 4.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163560
Predicted Effect probably benign
Transcript: ENSMUST00000163710
SMART Domains Protein: ENSMUSP00000129626
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
coiled coil region 2 29 N/A INTRINSIC
Pfam:Troponin 57 199 1.9e-39 PFAM
low complexity region 235 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163722
SMART Domains Protein: ENSMUSP00000129409
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 17 64 N/A INTRINSIC
Pfam:Troponin 76 118 1.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166161
SMART Domains Protein: ENSMUSP00000125795
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Troponin 56 198 3.4e-40 PFAM
low complexity region 234 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166268
SMART Domains Protein: ENSMUSP00000128476
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
coiled coil region 2 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166959
SMART Domains Protein: ENSMUSP00000129109
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 192 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178163
SMART Domains Protein: ENSMUSP00000137198
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 40 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209148
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. This gene encodes the TnI-cardiac protein and is exclusively expressed in cardiac muscle tissues. Mutations in this gene cause familial hypertrophic cardiomyopathy type 7 (CMH7) and familial restrictive cardiomyopathy (RCM). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking both functional copies of this gene die of acute heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,707 I433T probably benign Het
Aadacl3 T C 4: 144,456,190 Y236C probably benign Het
Adamts12 T A 15: 11,331,780 C1461* probably null Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
Atp6v1c1 A G 15: 38,690,550 N315S probably damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
C2cd4d G T 3: 94,363,823 R132L probably damaging Het
Cd244 A G 1: 171,574,207 Y167C probably damaging Het
Chd4 A G 6: 125,122,862 N1666D possibly damaging Het
Cubn A G 2: 13,381,837 I1539T possibly damaging Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Dgka C T 10: 128,729,594 probably null Het
Ephb4 T G 5: 137,369,804 V737G probably damaging Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Exoc4 G T 6: 33,580,030 C490F probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gpbp1l1 A G 4: 116,581,282 M192V possibly damaging Het
Ireb2 A G 9: 54,882,387 K115R probably benign Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr1038-ps C T 2: 86,122,854 T310I probably benign Het
Olfr652 G A 7: 104,564,976 V252I probably benign Het
Pcdhb2 G C 18: 37,296,363 R463P probably benign Het
Pcdhgb6 A T 18: 37,742,473 D78V possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Prelid3b C A 2: 174,469,362 W59L probably benign Het
Prex2 T G 1: 11,112,743 S405R probably damaging Het
Rp1 G A 1: 4,351,994 Q248* probably null Het
Rspo4 T A 2: 151,867,815 C47S probably damaging Het
Ryr3 C A 2: 112,766,311 M2499I probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Tcn2 T C 11: 3,917,649 *431W probably null Het
Tert A G 13: 73,627,988 E286G probably benign Het
Unc79 T C 12: 102,998,440 I49T possibly damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Znfx1 T A 2: 167,056,761 H81L probably benign Het
Other mutations in Tnni3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1589:Tnni3 UTSW 7 4520526 missense probably damaging 1.00
R2259:Tnni3 UTSW 7 4519406 missense probably benign 0.11
R5696:Tnni3 UTSW 7 4520454 missense probably benign 0.03
R5954:Tnni3 UTSW 7 4519540 missense probably damaging 1.00
R7338:Tnni3 UTSW 7 4521380 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCACGTTCTATGCTCTCTG -3'
(R):5'- CAAGAAGTTTGCCAGGTTGAC -3'

Sequencing Primer
(F):5'- TAGCCCATGTGAGAAACCCATGTTAG -3'
(R):5'- TTGACTGAAGAGACAGGAAGTGCTC -3'
Posted On2019-05-13