Incidental Mutation 'R6980:Unc79'
ID543788
Institutional Source Beutler Lab
Gene Symbol Unc79
Ensembl Gene ENSMUSG00000021198
Gene Nameunc-79 homolog (C. elegans)
Synonyms9030205A07Rik, Mlca3
MMRRC Submission
Accession Numbers

Genbank: NM_001081017; MGI: 2684729; Ensembl: ENSMUST00000085079

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6980 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location102948859-103184065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103059500 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 382 (R382K)
Ref Sequence ENSEMBL: ENSMUSP00000136332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085079] [ENSMUST00000101099] [ENSMUST00000178001] [ENSMUST00000178076] [ENSMUST00000179002]
Predicted Effect probably benign
Transcript: ENSMUST00000085079
AA Change: R258K

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000082156
Gene: ENSMUSG00000021198
AA Change: R258K

DomainStartEndE-ValueType
Pfam:UNC-79 1 469 3.1e-223 PFAM
low complexity region 732 737 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1428 1440 N/A INTRINSIC
low complexity region 1471 1476 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1490 1504 N/A INTRINSIC
low complexity region 1541 1556 N/A INTRINSIC
low complexity region 1861 1870 N/A INTRINSIC
low complexity region 2237 2246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101099
AA Change: R435K

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098659
Gene: ENSMUSG00000021198
AA Change: R435K

DomainStartEndE-ValueType
Pfam:UNC-79 113 646 1.2e-226 PFAM
low complexity region 909 914 N/A INTRINSIC
low complexity region 1023 1039 N/A INTRINSIC
low complexity region 1145 1154 N/A INTRINSIC
low complexity region 1291 1302 N/A INTRINSIC
low complexity region 1490 1502 N/A INTRINSIC
low complexity region 1605 1617 N/A INTRINSIC
low complexity region 1648 1653 N/A INTRINSIC
low complexity region 1654 1666 N/A INTRINSIC
low complexity region 1667 1681 N/A INTRINSIC
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1999 2008 N/A INTRINSIC
low complexity region 2375 2384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178001
SMART Domains Protein: ENSMUSP00000137132
Gene: ENSMUSG00000021198

DomainStartEndE-ValueType
Pfam:UNC-79 1 80 1.2e-30 PFAM
Pfam:UNC-79 78 188 2.1e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178076
AA Change: R239K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136888
Gene: ENSMUSG00000021198
AA Change: R239K

DomainStartEndE-ValueType
Pfam:UNC-79 1 450 4.2e-213 PFAM
low complexity region 713 718 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 1117 1128 N/A INTRINSIC
low complexity region 1316 1328 N/A INTRINSIC
low complexity region 1431 1443 N/A INTRINSIC
low complexity region 1474 1479 N/A INTRINSIC
low complexity region 1480 1492 N/A INTRINSIC
low complexity region 1493 1507 N/A INTRINSIC
low complexity region 1544 1559 N/A INTRINSIC
low complexity region 1864 1873 N/A INTRINSIC
low complexity region 2240 2249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179002
AA Change: R382K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136332
Gene: ENSMUSG00000021198
AA Change: R382K

DomainStartEndE-ValueType
Pfam:UNC-79 60 593 1.3e-226 PFAM
low complexity region 856 861 N/A INTRINSIC
low complexity region 970 986 N/A INTRINSIC
low complexity region 1092 1101 N/A INTRINSIC
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1509 1521 N/A INTRINSIC
low complexity region 1624 1636 N/A INTRINSIC
low complexity region 1667 1672 N/A INTRINSIC
low complexity region 1673 1685 N/A INTRINSIC
low complexity region 1686 1700 N/A INTRINSIC
low complexity region 1737 1752 N/A INTRINSIC
low complexity region 2057 2066 N/A INTRINSIC
low complexity region 2433 2442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NALCN channel is responsible for Na(+) leak currents. The protein encoded by this gene, along with UNC80, is an accessory subunit of the NALCN channel that contributes to the Ca(2+) sensitivity of the channel. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation results in lethality within the first week after birth, mostly at P0 or P1. Pups fail to nurse and have no milk in stomachs resulting in weakness, inactivity and no weight gain. [provided by MGI curators]
Allele List at MGI

 All alleles(2) : Targeted, knock-out(1) Chemically induced(1)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C A 2: 25,440,866 R1189S possibly damaging Het
Abcf2 T C 5: 24,565,972 Q594R probably benign Het
Abhd18 G A 3: 40,933,780 S353N probably benign Het
Adrb1 G T 19: 56,723,614 A415S probably benign Het
Art2b T C 7: 101,580,473 N73S probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGT 3: 95,888,168 probably benign Het
Cacna1a A G 8: 84,612,285 M1753V possibly damaging Het
Cbx8 A T 11: 119,039,461 I102N possibly damaging Het
Ccdc178 T A 18: 22,105,563 E332D probably benign Het
Cfap74 G A 4: 155,466,352 probably benign Het
Chat A T 14: 32,424,154 M354K probably benign Het
Cmas A G 6: 142,756,800 T10A probably damaging Het
Cyb561d1 A T 3: 108,200,159 L51H probably benign Het
D030056L22Rik A T 19: 18,717,265 N128I probably damaging Het
D130043K22Rik G T 13: 24,864,781 A423S probably damaging Het
Dnah14 T C 1: 181,648,230 I1349T probably benign Het
Dnajb3 T G 1: 88,205,014 D222A probably damaging Het
Dtx1 T C 5: 120,681,357 E592G probably damaging Het
Dzank1 C T 2: 144,490,136 G427R possibly damaging Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Eif4e1b T A 13: 54,784,103 probably null Het
Ell2 A G 13: 75,756,376 M159V probably null Het
Eml4 G A 17: 83,451,017 V377I probably benign Het
Fryl A T 5: 73,050,430 S2466T probably benign Het
Gfpt1 C A 6: 87,077,089 T426K probably damaging Het
Gm28710 T A 5: 16,826,946 V533D possibly damaging Het
Gm49355 T C 14: 12,307,173 probably benign Het
Gm5114 T C 7: 39,409,200 I332V probably benign Het
Gpr15 T A 16: 58,718,742 probably benign Het
Gpr179 T C 11: 97,334,858 E2157G probably benign Het
Gramd4 A G 15: 86,131,969 N482S probably benign Het
Hfm1 A T 5: 106,880,477 I829K probably benign Het
Hydin A T 8: 110,413,284 E728D possibly damaging Het
Ifngr2 T A 16: 91,560,007 V143E probably damaging Het
Ift172 T C 5: 31,257,386 D1390G probably benign Het
Kdf1 A T 4: 133,528,827 D285V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mdn1 G A 4: 32,726,942 probably null Het
Megf11 A G 9: 64,705,850 E1016G probably damaging Het
Mixl1 G A 1: 180,696,888 A42V possibly damaging Het
Mpp2 A G 11: 102,059,328 W567R probably damaging Het
Mrgpra6 A G 7: 47,188,949 L136P probably damaging Het
Mroh7 T A 4: 106,700,237 I759L probably benign Het
Nrxn2 A G 19: 6,450,579 D277G probably benign Het
Nup210l A T 3: 90,119,927 K205N probably benign Het
Olfr1040 A T 2: 86,146,337 Y132* probably null Het
Olfr1284 A G 2: 111,379,275 I92V possibly damaging Het
Olfr475-ps1 A G 2: 88,623,595 *97W probably null Het
Olfr603 T C 7: 103,383,096 E302G probably benign Het
Oxnad1 C T 14: 32,085,619 probably benign Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcdhgb5 C T 18: 37,733,539 H796Y possibly damaging Het
Pdlim7 G T 13: 55,508,228 D126E probably benign Het
Pfdn2 C T 1: 171,357,897 probably benign Het
Piezo2 T A 18: 63,082,961 probably null Het
Pms2 A T 5: 143,912,024 I43L probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ptpn4 T A 1: 119,743,421 E202D possibly damaging Het
Rnf40 T A 7: 127,594,677 V455E probably damaging Het
Rp1l1 A G 14: 64,028,720 N585S probably benign Het
Rrp12 A G 19: 41,890,143 S188P probably damaging Het
Rsbn1l T A 5: 20,896,484 H686L probably benign Het
Runx2 C T 17: 44,735,316 V107I possibly damaging Het
Rusc2 A G 4: 43,422,846 I994M probably benign Het
Ryr1 T A 7: 29,109,387 D420V probably benign Het
Sash1 T C 10: 8,729,848 Q926R probably benign Het
Scgb3a2 T A 18: 43,764,434 I6N probably damaging Het
Sdc3 T A 4: 130,816,922 probably benign Het
Sik2 A G 9: 50,897,455 V658A probably benign Het
Slc25a39 A G 11: 102,405,775 V81A probably damaging Het
Snai2 T A 16: 14,708,249 S255T possibly damaging Het
Sorbs1 A T 19: 40,327,616 Y371* probably null Het
Spata31d1b A T 13: 59,715,422 H128L probably benign Het
Spdl1 A T 11: 34,830,879 M1K probably null Het
Tgm3 T A 2: 130,026,777 N211K probably benign Het
Tmem116 T C 5: 121,467,987 probably null Het
Tmem132e T A 11: 82,438,386 probably null Het
Tmem53 T C 4: 117,268,508 C251R probably damaging Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Trp63 T A 16: 25,802,093 F12I probably benign Het
Ttn C T 2: 76,879,057 probably null Het
Tubgcp4 T C 2: 121,195,465 V596A probably benign Het
Ugt2a3 A C 5: 87,325,632 H475Q probably damaging Het
Vmn2r58 T C 7: 41,864,238 H327R possibly damaging Het
Vmn2r7 G A 3: 64,716,566 T111I possibly damaging Het
Zfp318 T A 17: 46,397,212 Y399N probably damaging Het
Other mutations in Unc79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Unc79 APN 12 103169647 missense possibly damaging 0.68
IGL00835:Unc79 APN 12 103141890 splice site probably benign
IGL00917:Unc79 APN 12 103088507 missense possibly damaging 0.53
IGL01012:Unc79 APN 12 103112455 missense probably damaging 1.00
IGL01121:Unc79 APN 12 103165631 missense probably damaging 0.99
IGL01303:Unc79 APN 12 103161867 missense possibly damaging 0.94
IGL01305:Unc79 APN 12 103001871 missense probably damaging 0.99
IGL01315:Unc79 APN 12 103088521 missense possibly damaging 0.66
IGL01388:Unc79 APN 12 103169759 splice site probably benign
IGL01415:Unc79 APN 12 103108685 missense probably damaging 1.00
IGL01447:Unc79 APN 12 103078918 missense probably damaging 1.00
IGL01655:Unc79 APN 12 103168287 missense probably benign 0.00
IGL01662:Unc79 APN 12 103149020 missense possibly damaging 0.92
IGL01728:Unc79 APN 12 103165684 missense probably damaging 0.98
IGL01767:Unc79 APN 12 103141997 missense probably damaging 1.00
IGL02080:Unc79 APN 12 103001975 missense probably damaging 1.00
IGL02115:Unc79 APN 12 102998674 missense probably damaging 1.00
IGL02176:Unc79 APN 12 102998747 splice site probably null
IGL02186:Unc79 APN 12 103011283 missense probably benign 0.04
IGL02205:Unc79 APN 12 103079001 missense probably damaging 1.00
IGL02337:Unc79 APN 12 103156446 splice site probably benign
IGL02498:Unc79 APN 12 103171578 missense probably damaging 0.99
IGL02508:Unc79 APN 12 103112276 missense probably damaging 0.97
IGL02508:Unc79 APN 12 103112018 splice site probably benign
IGL02557:Unc79 APN 12 103182159 splice site probably benign
IGL02589:Unc79 APN 12 103173496 missense probably damaging 1.00
IGL02611:Unc79 APN 12 103165708 missense probably damaging 0.97
IGL02728:Unc79 APN 12 103122429 missense possibly damaging 0.53
IGL02827:Unc79 APN 12 103074846 missense possibly damaging 0.88
IGL03028:Unc79 APN 12 103173526 missense possibly damaging 0.83
IGL03144:Unc79 APN 12 103042142 missense probably damaging 1.00
IGL03229:Unc79 APN 12 103134539 missense probably damaging 0.99
IGL03269:Unc79 APN 12 103088677 missense probably damaging 1.00
IGL03325:Unc79 APN 12 103169610 missense probably damaging 0.98
pencil-thin UTSW 12 103108781 splice site probably null
sweetpea UTSW 12 103059518 missense probably damaging 1.00
3-1:Unc79 UTSW 12 103072750 nonsense probably null
ANU22:Unc79 UTSW 12 103001871 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0067:Unc79 UTSW 12 103059518 missense probably damaging 1.00
R0067:Unc79 UTSW 12 103059518 missense probably damaging 1.00
R0107:Unc79 UTSW 12 103134525 missense possibly damaging 0.70
R0110:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0128:Unc79 UTSW 12 103088434 splice site probably benign
R0166:Unc79 UTSW 12 103156553 missense probably damaging 1.00
R0208:Unc79 UTSW 12 103092027 missense probably benign 0.00
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0218:Unc79 UTSW 12 103108781 splice site probably null
R0244:Unc79 UTSW 12 103112891 missense probably damaging 1.00
R0305:Unc79 UTSW 12 103113200 missense probably benign 0.18
R0310:Unc79 UTSW 12 103061407 missense probably damaging 1.00
R0325:Unc79 UTSW 12 103171644 missense probably damaging 0.98
R0369:Unc79 UTSW 12 103088772 critical splice donor site probably null
R0450:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0503:Unc79 UTSW 12 103078868 missense probably benign 0.01
R0542:Unc79 UTSW 12 103094178 splice site probably benign
R0845:Unc79 UTSW 12 103173444 splice site probably benign
R0893:Unc79 UTSW 12 102991428 missense probably damaging 1.00
R1078:Unc79 UTSW 12 103074853 missense probably benign 0.03
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1159:Unc79 UTSW 12 103047052 splice site probably benign
R1191:Unc79 UTSW 12 103047012 nonsense probably null
R1307:Unc79 UTSW 12 103070076 missense probably damaging 1.00
R1368:Unc79 UTSW 12 103156513 missense probably damaging 1.00
R1476:Unc79 UTSW 12 103183525 missense probably damaging 1.00
R1650:Unc79 UTSW 12 103112793 missense possibly damaging 0.85
R1777:Unc79 UTSW 12 103112455 missense probably damaging 1.00
R1796:Unc79 UTSW 12 103142746 missense probably damaging 0.99
R1824:Unc79 UTSW 12 103059320 missense probably damaging 1.00
R1830:Unc79 UTSW 12 103134478 missense probably damaging 1.00
R1927:Unc79 UTSW 12 103169692 missense probably damaging 1.00
R1958:Unc79 UTSW 12 102991362 missense probably damaging 1.00
R1958:Unc79 UTSW 12 103074919 missense probably benign 0.19
R1980:Unc79 UTSW 12 103011279 nonsense probably null
R2019:Unc79 UTSW 12 103171571 critical splice acceptor site probably null
R2290:Unc79 UTSW 12 103146366 missense probably damaging 1.00
R2939:Unc79 UTSW 12 102991425 missense probably damaging 1.00
R2962:Unc79 UTSW 12 103095119 missense possibly damaging 0.72
R3176:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3276:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3683:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3684:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3686:Unc79 UTSW 12 103088661 missense probably damaging 1.00
R3760:Unc79 UTSW 12 103092705 missense probably damaging 1.00
R4031:Unc79 UTSW 12 103072759 missense possibly damaging 0.46
R4039:Unc79 UTSW 12 103074949 missense possibly damaging 0.88
R4110:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4113:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4159:Unc79 UTSW 12 103070253 intron probably benign
R4273:Unc79 UTSW 12 103122353 missense probably damaging 0.99
R4292:Unc79 UTSW 12 103183444 missense probably damaging 0.99
R4334:Unc79 UTSW 12 103078974 missense probably benign
R4513:Unc79 UTSW 12 103021760 missense probably damaging 1.00
R4562:Unc79 UTSW 12 102991461 missense probably damaging 1.00
R4576:Unc79 UTSW 12 103001803 splice site probably benign
R4645:Unc79 UTSW 12 103112822 missense probably benign
R4758:Unc79 UTSW 12 103161821 nonsense probably null
R4787:Unc79 UTSW 12 103046998 missense probably damaging 1.00
R4852:Unc79 UTSW 12 103173466 missense probably damaging 0.98
R4883:Unc79 UTSW 12 103094333 missense probably damaging 0.99
R4898:Unc79 UTSW 12 103161820 missense probably damaging 0.99
R4979:Unc79 UTSW 12 103112432 missense probably benign
R5044:Unc79 UTSW 12 103112703 missense probably benign 0.32
R5053:Unc79 UTSW 12 103104748 missense probably damaging 1.00
R5061:Unc79 UTSW 12 103168441 missense possibly damaging 0.94
R5075:Unc79 UTSW 12 103074954 missense possibly damaging 0.63
R5101:Unc79 UTSW 12 103112510 missense probably damaging 1.00
R5236:Unc79 UTSW 12 103094395 critical splice donor site probably null
R5240:Unc79 UTSW 12 103070751 missense probably damaging 0.99
R5383:Unc79 UTSW 12 103104627 missense possibly damaging 0.53
R5461:Unc79 UTSW 12 103112138 missense probably damaging 1.00
R5535:Unc79 UTSW 12 103169703 missense possibly damaging 0.84
R5609:Unc79 UTSW 12 103128268 missense probably benign
R5639:Unc79 UTSW 12 103171572 missense probably damaging 1.00
R5704:Unc79 UTSW 12 103001943 missense probably damaging 1.00
R5923:Unc79 UTSW 12 103112468 missense probably damaging 1.00
R5925:Unc79 UTSW 12 103125730 splice site probably null
R5975:Unc79 UTSW 12 103125626 missense possibly damaging 0.53
R6047:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6156:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6175:Unc79 UTSW 12 103183449 missense probably damaging 0.98
R6292:Unc79 UTSW 12 103142732 missense possibly damaging 0.88
R6313:Unc79 UTSW 12 103112619 missense probably damaging 1.00
R6391:Unc79 UTSW 12 103021010 missense probably damaging 1.00
R6405:Unc79 UTSW 12 103168336 missense probably damaging 0.97
R6416:Unc79 UTSW 12 103131646 missense possibly damaging 0.86
R6467:Unc79 UTSW 12 103173512 missense probably damaging 1.00
R6573:Unc79 UTSW 12 103061388 missense probably damaging 1.00
R6614:Unc79 UTSW 12 102991430 missense probably damaging 1.00
R6654:Unc79 UTSW 12 103079048 missense probably damaging 0.99
R6654:Unc79 UTSW 12 103079049 missense probably damaging 1.00
R6700:Unc79 UTSW 12 103125703 missense possibly damaging 0.92
R6724:Unc79 UTSW 12 103104861 missense probably damaging 1.00
R6819:Unc79 UTSW 12 103142008 missense probably benign 0.12
R6869:Unc79 UTSW 12 103113072 missense probably benign 0.33
R6879:Unc79 UTSW 12 103148787 intron probably null
R6942:Unc79 UTSW 12 103122445 critical splice donor site probably null
R6961:Unc79 UTSW 12 103112915 missense probably damaging 1.00
R6973:Unc79 UTSW 12 102998440 missense possibly damaging 0.86
R7124:Unc79 UTSW 12 103061393 missense probably damaging 0.99
R7144:Unc79 UTSW 12 103142626 missense probably benign 0.06
R7197:Unc79 UTSW 12 103112506 missense probably benign
R7209:Unc79 UTSW 12 103125624 missense probably benign
R7232:Unc79 UTSW 12 103134475 missense possibly damaging 0.49
R7304:Unc79 UTSW 12 103063190 missense probably damaging 1.00
R7354:Unc79 UTSW 12 103142702 missense possibly damaging 0.79
R7384:Unc79 UTSW 12 103171578 missense probably benign 0.11
R7400:Unc79 UTSW 12 103104630 missense probably damaging 1.00
X0017:Unc79 UTSW 12 103108261 missense probably damaging 0.99
X0028:Unc79 UTSW 12 102991403 missense probably damaging 1.00
Z1088:Unc79 UTSW 12 103021012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCAGAAGGGCAGTGGTC -3'
(R):5'- TCTGCTTAAGTAACTGAAGGGC -3'

Sequencing Primer
(F):5'- AAGGGCAGTGGTCACCTG -3'
(R):5'- CAAGGCCTTGCACATGATTG -3'
Posted On2019-05-13