Incidental Mutation 'R6980:Trp63'
ID543801
Institutional Source Beutler Lab
Gene Symbol Trp63
Ensembl Gene ENSMUSG00000022510
Gene Nametransformation related protein 63
SynonymsTAp63, deltaNp63, p63, p73L, p51/p63, KET protein, Trp53rp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R6980 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location25683763-25892102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25802093 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 12 (F12I)
Ref Sequence ENSEMBL: ENSMUSP00000110961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040231] [ENSMUST00000065523] [ENSMUST00000115304] [ENSMUST00000115305] [ENSMUST00000115306] [ENSMUST00000115307] [ENSMUST00000115308] [ENSMUST00000115310]
Predicted Effect probably benign
Transcript: ENSMUST00000040231
AA Change: F12I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038117
Gene: ENSMUSG00000022510
AA Change: F12I

DomainStartEndE-ValueType
Pfam:P53 69 265 5.4e-110 PFAM
Pfam:P53_tetramer 297 338 2.4e-20 PFAM
low complexity region 343 356 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
SAM 447 513 1.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065523
SMART Domains Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510

DomainStartEndE-ValueType
Pfam:P53 163 359 4.9e-110 PFAM
Pfam:P53_tetramer 391 432 2.2e-20 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115304
AA Change: F12I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110959
Gene: ENSMUSG00000022510
AA Change: F12I

DomainStartEndE-ValueType
Pfam:P53 69 265 1.5e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115305
AA Change: F12I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110960
Gene: ENSMUSG00000022510
AA Change: F12I

DomainStartEndE-ValueType
Pfam:P53 69 265 1.1e-110 PFAM
Pfam:P53_tetramer 297 338 5.5e-21 PFAM
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115306
AA Change: F12I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110961
Gene: ENSMUSG00000022510
AA Change: F12I

DomainStartEndE-ValueType
Pfam:P53 69 265 2.7e-110 PFAM
Pfam:P53_tetramer 293 334 9.2e-21 PFAM
low complexity region 339 352 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
SAM 443 509 1.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115307
SMART Domains Protein: ENSMUSP00000110962
Gene: ENSMUSG00000022510

DomainStartEndE-ValueType
Pfam:P53 163 200 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115308
SMART Domains Protein: ENSMUSP00000110963
Gene: ENSMUSG00000022510

DomainStartEndE-ValueType
Pfam:P53 163 359 3.6e-110 PFAM
Pfam:P53_tetramer 387 428 1.8e-20 PFAM
low complexity region 433 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115310
SMART Domains Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510

DomainStartEndE-ValueType
Pfam:P53 163 359 1.3e-112 PFAM
Pfam:P53_tetramer 391 431 7e-21 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
SAM 541 607 1.4e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C A 2: 25,440,866 R1189S possibly damaging Het
Abcf2 T C 5: 24,565,972 Q594R probably benign Het
Abhd18 G A 3: 40,933,780 S353N probably benign Het
Adrb1 G T 19: 56,723,614 A415S probably benign Het
Art2b T C 7: 101,580,473 N73S probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGT 3: 95,888,168 probably benign Het
Cacna1a A G 8: 84,612,285 M1753V possibly damaging Het
Cbx8 A T 11: 119,039,461 I102N possibly damaging Het
Ccdc178 T A 18: 22,105,563 E332D probably benign Het
Cfap74 G A 4: 155,466,352 probably benign Het
Chat A T 14: 32,424,154 M354K probably benign Het
Cmas A G 6: 142,756,800 T10A probably damaging Het
Cyb561d1 A T 3: 108,200,159 L51H probably benign Het
D030056L22Rik A T 19: 18,717,265 N128I probably damaging Het
D130043K22Rik G T 13: 24,864,781 A423S probably damaging Het
Dnah14 T C 1: 181,648,230 I1349T probably benign Het
Dnajb3 T G 1: 88,205,014 D222A probably damaging Het
Dtx1 T C 5: 120,681,357 E592G probably damaging Het
Dzank1 C T 2: 144,490,136 G427R possibly damaging Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Eif4e1b T A 13: 54,784,103 probably null Het
Ell2 A G 13: 75,756,376 M159V probably null Het
Eml4 G A 17: 83,451,017 V377I probably benign Het
Fryl A T 5: 73,050,430 S2466T probably benign Het
Gfpt1 C A 6: 87,077,089 T426K probably damaging Het
Gm28710 T A 5: 16,826,946 V533D possibly damaging Het
Gm49355 T C 14: 12,307,173 probably benign Het
Gm5114 T C 7: 39,409,200 I332V probably benign Het
Gpr15 T A 16: 58,718,742 probably benign Het
Gpr179 T C 11: 97,334,858 E2157G probably benign Het
Gramd4 A G 15: 86,131,969 N482S probably benign Het
Hfm1 A T 5: 106,880,477 I829K probably benign Het
Hydin A T 8: 110,413,284 E728D possibly damaging Het
Ifngr2 T A 16: 91,560,007 V143E probably damaging Het
Ift172 T C 5: 31,257,386 D1390G probably benign Het
Kdf1 A T 4: 133,528,827 D285V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mdn1 G A 4: 32,726,942 probably null Het
Megf11 A G 9: 64,705,850 E1016G probably damaging Het
Mixl1 G A 1: 180,696,888 A42V possibly damaging Het
Mpp2 A G 11: 102,059,328 W567R probably damaging Het
Mrgpra6 A G 7: 47,188,949 L136P probably damaging Het
Mroh7 T A 4: 106,700,237 I759L probably benign Het
Nrxn2 A G 19: 6,450,579 D277G probably benign Het
Nup210l A T 3: 90,119,927 K205N probably benign Het
Olfr1040 A T 2: 86,146,337 Y132* probably null Het
Olfr1284 A G 2: 111,379,275 I92V possibly damaging Het
Olfr475-ps1 A G 2: 88,623,595 *97W probably null Het
Olfr603 T C 7: 103,383,096 E302G probably benign Het
Oxnad1 C T 14: 32,085,619 probably benign Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcdhgb5 C T 18: 37,733,539 H796Y possibly damaging Het
Pdlim7 G T 13: 55,508,228 D126E probably benign Het
Pfdn2 C T 1: 171,357,897 probably benign Het
Piezo2 T A 18: 63,082,961 probably null Het
Pms2 A T 5: 143,912,024 I43L probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ptpn4 T A 1: 119,743,421 E202D possibly damaging Het
Rnf40 T A 7: 127,594,677 V455E probably damaging Het
Rp1l1 A G 14: 64,028,720 N585S probably benign Het
Rrp12 A G 19: 41,890,143 S188P probably damaging Het
Rsbn1l T A 5: 20,896,484 H686L probably benign Het
Runx2 C T 17: 44,735,316 V107I possibly damaging Het
Rusc2 A G 4: 43,422,846 I994M probably benign Het
Ryr1 T A 7: 29,109,387 D420V probably benign Het
Sash1 T C 10: 8,729,848 Q926R probably benign Het
Scgb3a2 T A 18: 43,764,434 I6N probably damaging Het
Sdc3 T A 4: 130,816,922 probably benign Het
Sik2 A G 9: 50,897,455 V658A probably benign Het
Slc25a39 A G 11: 102,405,775 V81A probably damaging Het
Snai2 T A 16: 14,708,249 S255T possibly damaging Het
Sorbs1 A T 19: 40,327,616 Y371* probably null Het
Spata31d1b A T 13: 59,715,422 H128L probably benign Het
Spdl1 A T 11: 34,830,879 M1K probably null Het
Tgm3 T A 2: 130,026,777 N211K probably benign Het
Tmem116 T C 5: 121,467,987 probably null Het
Tmem132e T A 11: 82,438,386 probably null Het
Tmem53 T C 4: 117,268,508 C251R probably damaging Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Ttn C T 2: 76,879,057 probably null Het
Tubgcp4 T C 2: 121,195,465 V596A probably benign Het
Ugt2a3 A C 5: 87,325,632 H475Q probably damaging Het
Unc79 G A 12: 103,059,500 R382K probably damaging Het
Vmn2r58 T C 7: 41,864,238 H327R possibly damaging Het
Vmn2r7 G A 3: 64,716,566 T111I possibly damaging Het
Zfp318 T A 17: 46,397,212 Y399N probably damaging Het
Other mutations in Trp63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Trp63 APN 16 25871076 missense probably damaging 1.00
IGL01402:Trp63 APN 16 25820385 splice site probably benign
IGL01404:Trp63 APN 16 25820385 splice site probably benign
IGL01874:Trp63 APN 16 25882585 missense possibly damaging 0.88
IGL01887:Trp63 APN 16 25865319 missense probably damaging 1.00
IGL02008:Trp63 APN 16 25862461 missense probably damaging 1.00
IGL02336:Trp63 APN 16 25820442 missense probably damaging 1.00
IGL02470:Trp63 APN 16 25820384 splice site probably benign
IGL02720:Trp63 APN 16 25863741 missense probably damaging 0.96
IGL03230:Trp63 APN 16 25889010 missense probably damaging 1.00
PIT4142001:Trp63 UTSW 16 25865263 missense probably damaging 1.00
R0086:Trp63 UTSW 16 25871087 missense probably damaging 1.00
R0281:Trp63 UTSW 16 25764302 splice site probably benign
R1448:Trp63 UTSW 16 25889120 missense possibly damaging 0.67
R1517:Trp63 UTSW 16 25889253 missense probably damaging 1.00
R1539:Trp63 UTSW 16 25884849 missense probably benign 0.02
R3922:Trp63 UTSW 16 25889009 missense probably damaging 1.00
R3977:Trp63 UTSW 16 25820740 intron probably benign
R3978:Trp63 UTSW 16 25820740 intron probably benign
R3979:Trp63 UTSW 16 25820740 intron probably benign
R4689:Trp63 UTSW 16 25865262 missense possibly damaging 0.90
R4870:Trp63 UTSW 16 25866218 makesense probably null
R5009:Trp63 UTSW 16 25868227 missense probably damaging 0.99
R5033:Trp63 UTSW 16 25763306 missense probably damaging 0.99
R5058:Trp63 UTSW 16 25882594 missense probably damaging 1.00
R5118:Trp63 UTSW 16 25889010 missense unknown
R5354:Trp63 UTSW 16 25684355 splice site probably null
R5363:Trp63 UTSW 16 25863718 missense probably damaging 0.99
R5668:Trp63 UTSW 16 25866185 missense possibly damaging 0.52
R6004:Trp63 UTSW 16 25763396 critical splice donor site probably null
R6029:Trp63 UTSW 16 25868214 missense probably damaging 1.00
R6170:Trp63 UTSW 16 25884853 missense probably benign 0.28
R6186:Trp63 UTSW 16 25876733 intron probably benign
R6266:Trp63 UTSW 16 25862460 missense probably damaging 0.99
R6466:Trp63 UTSW 16 25763358 missense probably damaging 1.00
R6486:Trp63 UTSW 16 25865340 missense probably damaging 0.99
R6913:Trp63 UTSW 16 25889168 missense probably damaging 1.00
R7097:Trp63 UTSW 16 25820477 missense probably damaging 1.00
R7122:Trp63 UTSW 16 25820477 missense probably damaging 1.00
Z1088:Trp63 UTSW 16 25763313 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCCTCATGCCTATAGTTGGG -3'
(R):5'- CTTCGAATACATAATGTCACCCAGG -3'

Sequencing Primer
(F):5'- GTGAACCTTAAAGTATGTACAGAGAG -3'
(R):5'- CCCTTTTCTTCTACTGTTTCATCTG -3'
Posted On2019-05-13