Incidental Mutation 'R6991:Notch4'
ID543875
Institutional Source Beutler Lab
Gene Symbol Notch4
Ensembl Gene ENSMUSG00000015468
Gene Namenotch 4
SynonymsInt3, N4, Int-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6991 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34564268-34588503 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 34584800 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1515 (E1515*)
Ref Sequence ENSEMBL: ENSMUSP00000015612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000173389]
Predicted Effect probably null
Transcript: ENSMUST00000015612
AA Change: E1515*
SMART Domains Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: E1515*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 24 60 3.2e-4 SMART
EGF 64 112 1.07e-5 SMART
EGF 118 152 5.49e-3 SMART
EGF 156 189 9.33e-6 SMART
EGF_CA 191 229 1.42e-10 SMART
EGF 234 271 1.11e-3 SMART
EGF 276 309 1.84e-4 SMART
EGF_CA 311 350 2.52e-11 SMART
EGF_CA 352 388 1.85e-9 SMART
EGF 392 427 1.58e-3 SMART
EGF_CA 429 470 2.46e-14 SMART
EGF_CA 472 508 5.03e-11 SMART
EGF_CA 510 546 6.74e-12 SMART
EGF_CA 548 584 2.98e-13 SMART
EGF_CA 586 622 7.63e-11 SMART
EGF_like 645 686 2.86e1 SMART
EGF 691 724 3.48e-5 SMART
EGF 729 762 3.62e-3 SMART
EGF_CA 764 800 1.48e-8 SMART
EGF 806 839 1.74e-5 SMART
EGF 844 877 2.3e-5 SMART
EGF 881 924 3.59e-7 SMART
EGF_CA 926 962 7.29e-8 SMART
EGF_CA 965 1000 4.42e-7 SMART
EGF_CA 1002 1040 4.56e-9 SMART
EGF 1045 1081 6.16e-6 SMART
EGF 1086 1122 8.65e-1 SMART
EGF 1129 1167 1.45e-2 SMART
NL 1159 1200 6.79e-13 SMART
NL 1203 1242 2.01e-15 SMART
NL 1243 1281 1.85e-14 SMART
NOD 1287 1341 4.37e-8 SMART
NODP 1373 1437 2.12e-6 SMART
transmembrane domain 1441 1463 N/A INTRINSIC
low complexity region 1525 1539 N/A INTRINSIC
ANK 1578 1623 2.5e3 SMART
ANK 1628 1657 1.12e-3 SMART
ANK 1661 1691 5.01e-1 SMART
ANK 1695 1724 1.65e-1 SMART
ANK 1728 1757 4.56e-4 SMART
ANK 1761 1790 2.88e-1 SMART
low complexity region 1889 1906 N/A INTRINSIC
low complexity region 1925 1937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151654
Predicted Effect probably benign
Transcript: ENSMUST00000151867
Predicted Effect probably benign
Transcript: ENSMUST00000173389
SMART Domains Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 28 64 3.2e-4 SMART
EGF 68 116 1.07e-5 SMART
EGF 122 156 5.49e-3 SMART
EGF 160 193 9.33e-6 SMART
EGF_CA 195 233 1.42e-10 SMART
EGF 238 275 1.11e-3 SMART
EGF 280 313 1.84e-4 SMART
EGF_CA 315 354 2.52e-11 SMART
EGF_CA 356 392 1.85e-9 SMART
EGF 396 431 1.58e-3 SMART
EGF_CA 433 474 2.46e-14 SMART
EGF_CA 476 512 5.03e-11 SMART
EGF_CA 514 550 6.74e-12 SMART
EGF_CA 552 588 2.98e-13 SMART
EGF_CA 590 626 7.63e-11 SMART
EGF_like 649 690 2.86e1 SMART
EGF 695 728 3.48e-5 SMART
EGF 733 766 3.62e-3 SMART
EGF_CA 768 804 1.48e-8 SMART
EGF 810 843 1.74e-5 SMART
EGF 848 881 2.3e-5 SMART
EGF 885 928 3.59e-7 SMART
EGF_like 930 955 7.02e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,580,446 V278D probably damaging Het
2410089E03Rik A G 15: 8,252,206 E2843G unknown Het
9930021J03Rik A G 19: 29,719,108 L995S possibly damaging Het
Akap12 G T 10: 4,357,122 E1311* probably null Het
Ankdd1a T A 9: 65,508,675 D186V probably benign Het
Birc6 A G 17: 74,562,095 E346G probably damaging Het
Ccr7 A C 11: 99,145,304 V264G probably damaging Het
Col7a1 T C 9: 108,983,919 probably null Het
Coq8a T C 1: 180,179,068 T132A probably benign Het
Cyp2b10 G A 7: 25,917,355 S407N probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Ddx42 G A 11: 106,239,144 V421I probably damaging Het
Dip2c T A 13: 9,551,860 L285* probably null Het
Dip2c C T 13: 9,634,832 S1232F probably damaging Het
Dner T A 1: 84,476,402 R402* probably null Het
Dpysl3 A T 18: 43,353,891 I317N probably damaging Het
Dusp23 T A 1: 172,631,657 Y146F probably benign Het
Eef1a2 C A 2: 181,148,628 V412L possibly damaging Het
Epha7 C T 4: 28,821,489 T218I probably damaging Het
Gigyf2 T A 1: 87,407,136 C284S probably damaging Het
Gm16427 T A 5: 93,484,374 N107I probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Hdhd5 A G 6: 120,510,169 V409A probably damaging Het
Kif9 T C 9: 110,494,622 Y236H probably damaging Het
Kri1 T C 9: 21,287,754 probably benign Het
Lig4 A T 8: 9,971,098 V894E probably damaging Het
Lrriq1 T C 10: 103,187,458 N982S probably damaging Het
Mapk8 T C 14: 33,410,884 I32V possibly damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mstn T C 1: 53,061,941 I59T probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Npw A C 17: 24,658,055 V124G probably benign Het
Nxph3 A G 11: 95,511,418 S57P probably damaging Het
Olfr1000 T C 2: 85,608,248 I221V possibly damaging Het
Olfr1145 G A 2: 87,810,443 D208N possibly damaging Het
Olfr1443 G T 19: 12,680,748 L213F probably benign Het
Olfr493 T A 7: 108,346,088 N298Y possibly damaging Het
Olfr677 T C 7: 105,056,564 I106T probably damaging Het
Opn4 A T 14: 34,593,907 L390M probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g2e G A 4: 138,880,675 C62Y probably damaging Het
Plcb4 G A 2: 135,910,194 V107M probably damaging Het
Prorsd1 A C 11: 29,514,486 probably benign Het
Prox2 A G 12: 85,087,391 L587P probably benign Het
Prr22 A G 17: 56,771,345 D166G possibly damaging Het
Ptprz1 G A 6: 23,002,687 R1592Q probably benign Het
Rarg C G 15: 102,241,915 R74P probably damaging Het
Rcan1 A G 16: 92,397,363 V54A probably benign Het
Rmdn2 A G 17: 79,621,310 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Serpina1a T C 12: 103,853,833 T385A probably benign Het
Slc44a3 T C 3: 121,532,165 Y12C probably benign Het
Smg1 C A 7: 118,167,868 probably benign Het
Spock3 A G 8: 63,355,381 *437W probably null Het
Sugct T A 13: 17,554,380 Q220H probably benign Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tnks C A 8: 34,834,493 R1274I probably damaging Het
Trp53bp1 C T 2: 121,208,040 R1439H probably damaging Het
Vmn1r16 G T 6: 57,322,884 S251* probably null Het
Vmn2r15 T A 5: 109,293,314 Q226L probably damaging Het
Vmn2r67 T G 7: 85,155,745 Y53S possibly damaging Het
Vmn2r99 A G 17: 19,378,110 N132S probably benign Het
Wdr73 T G 7: 80,891,856 T313P probably benign Het
Zfp65 C T 13: 67,708,521 R213Q probably damaging Het
Other mutations in Notch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Notch4 APN 17 34575561 critical splice donor site probably null
IGL01022:Notch4 APN 17 34565697 missense probably damaging 1.00
IGL01356:Notch4 APN 17 34581026 missense possibly damaging 0.67
IGL01634:Notch4 APN 17 34572588 missense probably damaging 1.00
IGL02150:Notch4 APN 17 34584613 missense probably damaging 1.00
IGL02248:Notch4 APN 17 34587198 missense probably damaging 1.00
IGL02271:Notch4 APN 17 34568471 missense probably damaging 1.00
IGL02299:Notch4 APN 17 34578004 missense probably damaging 1.00
IGL02561:Notch4 APN 17 34568160 splice site probably benign
IGL02604:Notch4 APN 17 34565388 splice site probably null
IGL03323:Notch4 APN 17 34582471 missense probably damaging 1.00
IGL03366:Notch4 APN 17 34572568 missense probably damaging 1.00
IGL03408:Notch4 APN 17 34565568 missense probably benign 0.03
K3955:Notch4 UTSW 17 34568462 missense probably damaging 1.00
R0123:Notch4 UTSW 17 34565363 missense possibly damaging 0.85
R0366:Notch4 UTSW 17 34581499 splice site probably benign
R0446:Notch4 UTSW 17 34565363 missense possibly damaging 0.85
R0490:Notch4 UTSW 17 34582890 missense probably damaging 1.00
R0504:Notch4 UTSW 17 34575091 missense probably damaging 1.00
R0545:Notch4 UTSW 17 34583433 missense probably damaging 1.00
R0702:Notch4 UTSW 17 34575203 missense probably damaging 1.00
R0763:Notch4 UTSW 17 34565332 nonsense probably null
R0854:Notch4 UTSW 17 34568572 missense probably damaging 1.00
R1082:Notch4 UTSW 17 34587390 missense probably damaging 1.00
R1196:Notch4 UTSW 17 34568863 missense probably damaging 1.00
R1316:Notch4 UTSW 17 34567470 missense probably damaging 1.00
R1493:Notch4 UTSW 17 34567682 nonsense probably null
R1527:Notch4 UTSW 17 34565744 missense probably damaging 1.00
R1548:Notch4 UTSW 17 34568422 missense probably damaging 1.00
R1718:Notch4 UTSW 17 34576763 splice site probably benign
R1855:Notch4 UTSW 17 34580962 missense probably benign 0.05
R1988:Notch4 UTSW 17 34587588 missense possibly damaging 0.59
R2022:Notch4 UTSW 17 34587528 missense probably damaging 1.00
R2023:Notch4 UTSW 17 34587528 missense probably damaging 1.00
R2078:Notch4 UTSW 17 34568715 critical splice acceptor site probably null
R2369:Notch4 UTSW 17 34585950 missense probably benign 0.15
R3846:Notch4 UTSW 17 34578097 missense probably damaging 1.00
R3874:Notch4 UTSW 17 34578069 nonsense probably null
R4087:Notch4 UTSW 17 34584435 missense probably damaging 1.00
R4456:Notch4 UTSW 17 34583833 missense probably damaging 0.99
R4628:Notch4 UTSW 17 34570185 missense probably damaging 1.00
R4728:Notch4 UTSW 17 34570205 missense probably benign 0.00
R4778:Notch4 UTSW 17 34582511 missense possibly damaging 0.95
R4818:Notch4 UTSW 17 34578716 splice site probably benign
R4828:Notch4 UTSW 17 34570060 missense probably damaging 1.00
R4830:Notch4 UTSW 17 34570118 missense probably damaging 1.00
R4859:Notch4 UTSW 17 34587180 missense probably damaging 1.00
R4871:Notch4 UTSW 17 34577562 missense possibly damaging 0.63
R5090:Notch4 UTSW 17 34580920 missense probably damaging 0.99
R5290:Notch4 UTSW 17 34565289 missense probably benign 0.01
R5363:Notch4 UTSW 17 34587123 missense probably damaging 1.00
R5860:Notch4 UTSW 17 34582418 missense probably damaging 1.00
R6352:Notch4 UTSW 17 34567461 missense probably damaging 1.00
R6385:Notch4 UTSW 17 34573814 missense probably null 0.16
R6422:Notch4 UTSW 17 34584559 missense probably benign
R6645:Notch4 UTSW 17 34587816 missense probably benign 0.00
R6836:Notch4 UTSW 17 34586100 missense probably damaging 0.96
R6943:Notch4 UTSW 17 34583603 missense probably benign
R7078:Notch4 UTSW 17 34582546 missense possibly damaging 0.94
R7168:Notch4 UTSW 17 34572693 missense probably benign 0.05
R7182:Notch4 UTSW 17 34583499 missense probably damaging 1.00
R7240:Notch4 UTSW 17 34576471 missense probably benign 0.00
R7247:Notch4 UTSW 17 34572517 missense probably damaging 1.00
R7556:Notch4 UTSW 17 34575470 missense not run
R7571:Notch4 UTSW 17 34583574 missense not run
X0054:Notch4 UTSW 17 34584495 missense probably damaging 1.00
X0067:Notch4 UTSW 17 34586084 nonsense probably null
Z1088:Notch4 UTSW 17 34587915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGAAGGCCTCAGACACAG -3'
(R):5'- AGCGAAGGTCATTGAGTTGAC -3'

Sequencing Primer
(F):5'- GACAACATTGGTCTTAAGTGAGAC -3'
(R):5'- ATTGAGTTGACCTTGCCACTG -3'
Posted On2019-05-13