Incidental Mutation 'R6992:Inpp4a'
ID543882
Institutional Source Beutler Lab
Gene Symbol Inpp4a
Ensembl Gene ENSMUSG00000026113
Gene Nameinositol polyphosphate-4-phosphatase, type I
Synonyms107kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R6992 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location37299865-37410736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37389691 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 699 (M699L)
Ref Sequence ENSEMBL: ENSMUSP00000027287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027287] [ENSMUST00000058307] [ENSMUST00000114933] [ENSMUST00000132401] [ENSMUST00000132615] [ENSMUST00000136846] [ENSMUST00000137266] [ENSMUST00000140264] [ENSMUST00000168546] [ENSMUST00000193774]
Predicted Effect probably damaging
Transcript: ENSMUST00000027287
AA Change: M699L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027287
Gene: ENSMUSG00000026113
AA Change: M699L

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000058307
AA Change: M423L

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057233
Gene: ENSMUSG00000026113
AA Change: M423L

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114933
AA Change: M434L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110583
Gene: ENSMUSG00000026113
AA Change: M434L

DomainStartEndE-ValueType
low complexity region 300 325 N/A INTRINSIC
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132401
AA Change: M732L

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123071
Gene: ENSMUSG00000026113
AA Change: M732L

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 602 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132615
AA Change: M698L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115249
Gene: ENSMUSG00000026113
AA Change: M698L

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136846
AA Change: M698L

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121518
Gene: ENSMUSG00000026113
AA Change: M698L

DomainStartEndE-ValueType
Blast:C2 49 142 9e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 559 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137266
AA Change: M737L

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121803
Gene: ENSMUSG00000026113
AA Change: M737L

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140264
AA Change: M693L

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121107
Gene: ENSMUSG00000026113
AA Change: M693L

DomainStartEndE-ValueType
Blast:C2 49 142 7e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 564 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168546
AA Change: M423L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130443
Gene: ENSMUSG00000026113
AA Change: M423L

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193774
SMART Domains Protein: ENSMUSP00000142118
Gene: ENSMUSG00000026113

DomainStartEndE-ValueType
Blast:C2 45 87 7e-13 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Mg++ independent enzyme that hydrolyzes the 4-position phosphate from the inositol ring of phosphatidylinositol 3,4-bisphosphate, inositol 1,3,4-trisphosphate, and inositol 3,4-bisphosphate. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit small size, ataxia, loss of cerebellar and hippocampal CA1 neurons, and death by 24 days of age from seizures and/or malnutrition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,672 M128T probably benign Het
4921539E11Rik C T 4: 103,242,793 S171N possibly damaging Het
6030468B19Rik T G 11: 117,797,768 M1R probably null Het
9530053A07Rik T A 7: 28,140,183 F474I probably benign Het
A730049H05Rik T C 6: 92,827,994 probably benign Het
AC125199.3 G T 16: 88,812,027 H52Q possibly damaging Het
Adam34 A T 8: 43,652,605 M1K probably null Het
Adgrf5 T C 17: 43,452,323 probably null Het
Antxr2 T C 5: 97,960,705 T316A probably benign Het
Cc2d1a A T 8: 84,134,913 V714D probably damaging Het
Cd96 A G 16: 46,049,724 S461P possibly damaging Het
Cdc16 C A 8: 13,759,188 A51E probably benign Het
Chd4 T A 6: 125,114,376 D1243E probably benign Het
Cntf A T 19: 12,765,333 I21N probably damaging Het
Col11a2 C T 17: 34,047,144 A282V probably benign Het
Col14a1 T A 15: 55,411,562 probably null Het
Cyp2b9 T C 7: 26,201,139 Y401H probably benign Het
Dlgap4 A G 2: 156,748,940 probably null Het
Fancd2 T C 6: 113,571,018 probably null Het
Frem1 A G 4: 82,940,362 V1622A possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Gstm4 A G 3: 108,044,665 M3T possibly damaging Het
Hdac10 T C 15: 89,125,331 D466G probably benign Het
Hook2 A G 8: 85,002,556 E625G probably damaging Het
Hspbp1 G C 7: 4,664,715 P260A probably benign Het
Igdcc3 C A 9: 65,181,571 Q411K probably damaging Het
Il18rap G A 1: 40,542,035 E356K probably benign Het
Klhdc1 A G 12: 69,253,757 H157R probably damaging Het
Klhl6 G T 16: 19,953,587 T336N probably damaging Het
March7 T C 2: 60,229,084 probably null Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlh3 T A 12: 85,235,720 N1412Y probably damaging Het
Mrps27 A G 13: 99,405,014 M209V probably benign Het
Mtor A T 4: 148,464,475 T572S probably benign Het
Neurog1 T C 13: 56,251,550 K128R probably damaging Het
Olfr124 T A 17: 37,805,863 N239K probably damaging Het
Olfr1484 A G 19: 13,585,447 I48V possibly damaging Het
Olfr981 T A 9: 40,022,600 L69* probably null Het
Pcdhgb1 A G 18: 37,681,599 K381R probably benign Het
Pdzd2 T C 15: 12,457,859 D306G probably damaging Het
Plekha5 C T 6: 140,543,908 T237I probably damaging Het
Pole A T 5: 110,332,499 I103F probably damaging Het
Ppfia2 A T 10: 106,474,854 Q74L possibly damaging Het
Ppm1d T C 11: 85,332,352 F261S probably damaging Het
Psg21 A T 7: 18,654,743 probably null Het
Ptprg T A 14: 11,962,602 F133L probably damaging Het
Rom1 G A 19: 8,929,205 probably benign Het
Rtn3 A G 19: 7,435,124 F762L probably damaging Het
Sec23ip T C 7: 128,765,440 S600P probably benign Het
Sema4b T A 7: 80,220,152 I396N probably damaging Het
Serpina3k T A 12: 104,341,107 D199E probably benign Het
Slc19a1 A G 10: 77,049,706 D480G possibly damaging Het
Slc8b1 G A 5: 120,527,815 V404M probably damaging Het
Slco1a4 T C 6: 141,819,604 D304G probably benign Het
Smpdl3b G T 4: 132,745,141 A107D possibly damaging Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tmem245 A G 4: 56,937,940 F203L probably benign Het
Tnip1 T A 11: 54,918,716 I442F probably benign Het
Txnip A G 3: 96,559,123 K127R possibly damaging Het
Usp32 A C 11: 85,032,088 L172R probably damaging Het
Vmn2r66 A G 7: 85,005,228 S508P possibly damaging Het
Vwa5b2 T A 16: 20,598,202 Y550N probably damaging Het
Wdr81 G A 11: 75,451,786 A885V probably benign Het
Other mutations in Inpp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Inpp4a APN 1 37388905 missense probably damaging 1.00
IGL01821:Inpp4a APN 1 37377717 missense probably damaging 1.00
IGL02015:Inpp4a APN 1 37389712 missense probably damaging 1.00
IGL02036:Inpp4a APN 1 37377569 intron probably benign
IGL02040:Inpp4a APN 1 37396085 missense probably damaging 0.99
IGL02082:Inpp4a APN 1 37366627 intron probably benign
IGL02318:Inpp4a APN 1 37368303 missense probably damaging 1.00
IGL02555:Inpp4a APN 1 37379968 missense possibly damaging 0.70
IGL02622:Inpp4a APN 1 37379034 missense probably benign 0.26
R0265:Inpp4a UTSW 1 37378986 missense probably damaging 1.00
R0388:Inpp4a UTSW 1 37396160 missense probably damaging 0.96
R0543:Inpp4a UTSW 1 37369492 intron probably benign
R1269:Inpp4a UTSW 1 37389742 missense probably benign 0.01
R1719:Inpp4a UTSW 1 37398799 missense probably damaging 1.00
R1799:Inpp4a UTSW 1 37392978 missense possibly damaging 0.56
R2127:Inpp4a UTSW 1 37366919 missense probably benign 0.08
R2143:Inpp4a UTSW 1 37387746 missense probably damaging 1.00
R2174:Inpp4a UTSW 1 37396130 missense probably damaging 1.00
R2258:Inpp4a UTSW 1 37377696 missense probably damaging 1.00
R2327:Inpp4a UTSW 1 37366166 missense probably damaging 0.96
R2437:Inpp4a UTSW 1 37392956 missense probably damaging 1.00
R2897:Inpp4a UTSW 1 37366594 missense probably benign 0.07
R2898:Inpp4a UTSW 1 37366594 missense probably benign 0.07
R4830:Inpp4a UTSW 1 37371780 missense probably damaging 1.00
R4934:Inpp4a UTSW 1 37387841 missense possibly damaging 0.74
R5141:Inpp4a UTSW 1 37380087 missense probably benign 0.17
R5152:Inpp4a UTSW 1 37358535 missense possibly damaging 0.88
R5627:Inpp4a UTSW 1 37367773 missense probably damaging 0.96
R5789:Inpp4a UTSW 1 37372329 missense possibly damaging 0.75
R6004:Inpp4a UTSW 1 37372370 missense probably damaging 0.99
R6107:Inpp4a UTSW 1 37377748 missense probably damaging 0.98
R6180:Inpp4a UTSW 1 37380102 missense probably benign
R6434:Inpp4a UTSW 1 37398838 missense probably damaging 1.00
R6571:Inpp4a UTSW 1 37387758 missense probably damaging 1.00
R6766:Inpp4a UTSW 1 37372341 missense probably damaging 1.00
R7025:Inpp4a UTSW 1 37369423 missense probably benign 0.00
R7126:Inpp4a UTSW 1 37374272 missense probably benign 0.00
R7473:Inpp4a UTSW 1 37369453 missense probably benign 0.37
R7509:Inpp4a UTSW 1 37387830 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGTGCATAGGAAGCTTGAG -3'
(R):5'- CTGGGAAGGCTATATGCAATGC -3'

Sequencing Primer
(F):5'- GTTTCTGCAGCCACATCGG -3'
(R):5'- GGCTATATGCAATGCTCTAAAGG -3'
Posted On2019-05-13