Incidental Mutation 'R0608:Cds1'
ID54392
Institutional Source Beutler Lab
Gene Symbol Cds1
Ensembl Gene ENSMUSG00000029330
Gene NameCDP-diacylglycerol synthase 1
Synonyms4833409J18Rik, phosphatidate cytidylyltransferase
MMRRC Submission 038797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R0608 (G1)
Quality Score202
Status Not validated
Chromosome5
Chromosomal Location101765130-101823858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101814433 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 305 (V305M)
Ref Sequence ENSEMBL: ENSMUSP00000031273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031273]
Predicted Effect probably damaging
Transcript: ENSMUST00000031273
AA Change: V305M

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031273
Gene: ENSMUSG00000029330
AA Change: V305M

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:CTP_transf_1 87 417 6.4e-89 PFAM
low complexity region 427 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200599
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ampd3 C A 7: 110,795,790 D315E probably damaging Het
Ampd3 T A 7: 110,795,791 F316I probably damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atxn2l A G 7: 126,501,416 probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Bckdhb T G 9: 83,953,736 F98V probably damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Ccdc28a G A 10: 18,224,951 R90C probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Cep128 T G 12: 90,999,535 probably benign Het
Cep72 A T 13: 74,038,304 H249Q probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Col11a1 T C 3: 114,218,715 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah17 G T 11: 118,090,749 Y1716* probably null Het
Dnm1 T C 2: 32,335,824 E383G possibly damaging Het
Dst C A 1: 34,290,356 probably null Het
Edil3 T C 13: 89,184,849 S375P probably damaging Het
Eme1 A G 11: 94,650,082 C277R probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Fbxl6 C T 15: 76,536,753 V341M probably benign Het
Fgf14 A G 14: 124,676,603 S39P probably damaging Het
Fmo4 C T 1: 162,803,651 R249H possibly damaging Het
Gle1 T A 2: 29,940,228 D265E probably benign Het
Gml2 T C 15: 74,821,386 probably null Het
Golgb1 G T 16: 36,916,330 E1980* probably null Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Heca T C 10: 17,915,291 D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 T101A possibly damaging Het
Ift88 T C 14: 57,496,221 V707A probably benign Het
Kdm3a C T 6: 71,620,046 G252D probably benign Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Kntc1 A T 5: 123,786,074 N1008Y probably damaging Het
Lrp2 G T 2: 69,486,243 N2131K probably benign Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magi3 C G 3: 104,017,557 G1092A probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrps26 G T 2: 130,563,858 R27L possibly damaging Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Naif1 T C 2: 32,454,896 M204T probably benign Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Neb A T 2: 52,326,757 D135E probably benign Het
Nlrp6 C T 7: 140,923,486 Q502* probably null Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Pnpla8 C T 12: 44,283,463 P48L probably benign Het
Rab44 T A 17: 29,147,343 probably null Het
Ranbp2 T C 10: 58,493,898 I3031T probably damaging Het
Rnf219 T C 14: 104,479,527 Y470C probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Serpinh1 A G 7: 99,349,394 C10R unknown Het
Sh2d4a A G 8: 68,346,694 Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spire1 T C 18: 67,528,875 R163G probably damaging Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Susd2 C T 10: 75,638,235 A509T probably benign Het
Sycp2 A G 2: 178,382,404 F396L probably damaging Het
Syne2 T C 12: 75,963,813 L2499P probably damaging Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tab2 C T 10: 7,920,119 V126I probably damaging Het
Tecpr1 T C 5: 144,211,499 T363A probably damaging Het
Terb2 A G 2: 122,186,335 D16G probably benign Het
Tm2d2 A G 8: 25,020,536 E137G probably benign Het
Trim30d T A 7: 104,472,485 H201L probably damaging Het
Tspan3 A G 9: 56,147,385 probably null Het
Ttn A T 2: 76,787,323 L16268Q probably damaging Het
Ttn A T 2: 76,796,185 probably null Het
Ubap2 T A 4: 41,218,319 T263S probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zeb2 A T 2: 44,996,126 M973K possibly damaging Het
Zfp229 A G 17: 21,746,634 E615G probably damaging Het
Zfp655 T A 5: 145,244,057 S242T possibly damaging Het
Zfp788 T A 7: 41,648,281 F62I possibly damaging Het
Zmynd8 A G 2: 165,787,158 probably null Het
Other mutations in Cds1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cds1 APN 5 101809901 missense probably damaging 0.99
IGL02052:Cds1 APN 5 101814472 missense probably benign 0.01
IGL02238:Cds1 APN 5 101814436 missense possibly damaging 0.84
IGL02449:Cds1 APN 5 101815928 missense probably damaging 1.00
IGL02833:Cds1 APN 5 101814466 missense possibly damaging 0.81
IGL02973:Cds1 APN 5 101812510 missense probably damaging 0.99
IGL02987:Cds1 APN 5 101812525 missense possibly damaging 0.85
R0076:Cds1 UTSW 5 101817840 splice site probably benign
R0200:Cds1 UTSW 5 101814433 missense probably damaging 0.97
R0285:Cds1 UTSW 5 101797038 missense probably damaging 1.00
R0932:Cds1 UTSW 5 101797025 missense probably damaging 0.99
R1444:Cds1 UTSW 5 101798379 missense probably damaging 1.00
R1585:Cds1 UTSW 5 101817962 splice site probably benign
R1781:Cds1 UTSW 5 101812550 missense possibly damaging 0.78
R2126:Cds1 UTSW 5 101812550 missense probably benign 0.34
R4804:Cds1 UTSW 5 101821523 missense probably damaging 1.00
R4990:Cds1 UTSW 5 101798379 missense probably damaging 1.00
R5176:Cds1 UTSW 5 101781420 missense possibly damaging 0.87
R5330:Cds1 UTSW 5 101798495 missense probably damaging 1.00
R5331:Cds1 UTSW 5 101798495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAAGACTGCATCAGCCCCGCC -3'
(R):5'- CCCTGGAACATTAACACCCCGTTTG -3'

Sequencing Primer
(F):5'- TGGAGATGTCATTCTCTAAAGGC -3'
(R):5'- CACCCCGTTTGATGATGTTTAAGAAG -3'
Posted On2013-07-11