Incidental Mutation 'R6992:Rtn3'
ID543940
Institutional Source Beutler Lab
Gene Symbol Rtn3
Ensembl Gene ENSMUSG00000024758
Gene Namereticulon 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6992 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location7425901-7483289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7435124 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 762 (F762L)
Ref Sequence ENSEMBL: ENSMUSP00000085496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025667] [ENSMUST00000065304] [ENSMUST00000088169] [ENSMUST00000088171]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025667
AA Change: F54L

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025667
Gene: ENSMUSG00000024758
AA Change: F54L

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
Pfam:Reticulon 49 219 8.7e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065304
AA Change: F781L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065810
Gene: ENSMUSG00000024758
AA Change: F781L

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Pfam:Reticulon 776 940 9.1e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000088169
AA Change: F73L

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085494
Gene: ENSMUSG00000024758
AA Change: F73L

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
Pfam:Reticulon 68 238 1.1e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088171
AA Change: F762L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085496
Gene: ENSMUSG00000024758
AA Change: F762L

DomainStartEndE-ValueType
low complexity region 4 56 N/A INTRINSIC
low complexity region 61 72 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Pfam:Reticulon 757 927 1.8e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the reticulon family of highly conserved genes that are preferentially expressed in neuroendocrine tissues. This family of proteins interact with, and modulate the activity of beta-amyloid converting enzyme 1 (BACE1), and the production of amyloid-beta. An increase in the expression of any reticulon protein substantially reduces the production of amyloid-beta, suggesting that reticulon proteins are negative modulators of BACE1 in cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, and pseudogenes of this gene are located on chromosomes 4 and 12. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,672 M128T probably benign Het
4921539E11Rik C T 4: 103,242,793 S171N possibly damaging Het
6030468B19Rik T G 11: 117,797,768 M1R probably null Het
9530053A07Rik T A 7: 28,140,183 F474I probably benign Het
A730049H05Rik T C 6: 92,827,994 probably benign Het
AC125199.3 G T 16: 88,812,027 H52Q possibly damaging Het
Adam34 A T 8: 43,652,605 M1K probably null Het
Adgrf5 T C 17: 43,452,323 probably null Het
Antxr2 T C 5: 97,960,705 T316A probably benign Het
Cc2d1a A T 8: 84,134,913 V714D probably damaging Het
Cd96 A G 16: 46,049,724 S461P possibly damaging Het
Cdc16 C A 8: 13,759,188 A51E probably benign Het
Chd4 T A 6: 125,114,376 D1243E probably benign Het
Cntf A T 19: 12,765,333 I21N probably damaging Het
Col11a2 C T 17: 34,047,144 A282V probably benign Het
Col14a1 T A 15: 55,411,562 probably null Het
Cyp2b9 T C 7: 26,201,139 Y401H probably benign Het
Dlgap4 A G 2: 156,748,940 probably null Het
Fancd2 T C 6: 113,571,018 probably null Het
Frem1 A G 4: 82,940,362 V1622A possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Gstm4 A G 3: 108,044,665 M3T possibly damaging Het
Hdac10 T C 15: 89,125,331 D466G probably benign Het
Hook2 A G 8: 85,002,556 E625G probably damaging Het
Hspbp1 G C 7: 4,664,715 P260A probably benign Het
Igdcc3 C A 9: 65,181,571 Q411K probably damaging Het
Il18rap G A 1: 40,542,035 E356K probably benign Het
Inpp4a A T 1: 37,389,691 M699L probably damaging Het
Klhdc1 A G 12: 69,253,757 H157R probably damaging Het
Klhl6 G T 16: 19,953,587 T336N probably damaging Het
March7 T C 2: 60,229,084 probably null Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlh3 T A 12: 85,235,720 N1412Y probably damaging Het
Mrps27 A G 13: 99,405,014 M209V probably benign Het
Mtor A T 4: 148,464,475 T572S probably benign Het
Neurog1 T C 13: 56,251,550 K128R probably damaging Het
Olfr124 T A 17: 37,805,863 N239K probably damaging Het
Olfr1484 A G 19: 13,585,447 I48V possibly damaging Het
Olfr981 T A 9: 40,022,600 L69* probably null Het
Pcdhgb1 A G 18: 37,681,599 K381R probably benign Het
Pdzd2 T C 15: 12,457,859 D306G probably damaging Het
Plekha5 C T 6: 140,543,908 T237I probably damaging Het
Pole A T 5: 110,332,499 I103F probably damaging Het
Ppfia2 A T 10: 106,474,854 Q74L possibly damaging Het
Ppm1d T C 11: 85,332,352 F261S probably damaging Het
Psg21 A T 7: 18,654,743 probably null Het
Ptprg T A 14: 11,962,602 F133L probably damaging Het
Rom1 G A 19: 8,929,205 probably benign Het
Sec23ip T C 7: 128,765,440 S600P probably benign Het
Sema4b T A 7: 80,220,152 I396N probably damaging Het
Serpina3k T A 12: 104,341,107 D199E probably benign Het
Slc19a1 A G 10: 77,049,706 D480G possibly damaging Het
Slc8b1 G A 5: 120,527,815 V404M probably damaging Het
Slco1a4 T C 6: 141,819,604 D304G probably benign Het
Smpdl3b G T 4: 132,745,141 A107D possibly damaging Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tmem245 A G 4: 56,937,940 F203L probably benign Het
Tnip1 T A 11: 54,918,716 I442F probably benign Het
Txnip A G 3: 96,559,123 K127R possibly damaging Het
Usp32 A C 11: 85,032,088 L172R probably damaging Het
Vmn2r66 A G 7: 85,005,228 S508P possibly damaging Het
Vwa5b2 T A 16: 20,598,202 Y550N probably damaging Het
Wdr81 G A 11: 75,451,786 A885V probably benign Het
Other mutations in Rtn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Rtn3 APN 19 7435069 missense probably damaging 1.00
IGL01025:Rtn3 APN 19 7483041 missense unknown
IGL01347:Rtn3 APN 19 7457280 missense probably benign 0.01
IGL01845:Rtn3 APN 19 7457876 missense probably damaging 1.00
IGL02217:Rtn3 APN 19 7435084 missense probably damaging 0.99
IGL03024:Rtn3 APN 19 7483090 utr 5 prime probably benign
R0399:Rtn3 UTSW 19 7457876 missense probably damaging 1.00
R0633:Rtn3 UTSW 19 7457593 missense probably benign 0.03
R0826:Rtn3 UTSW 19 7467880 intron probably benign
R1327:Rtn3 UTSW 19 7431011 missense possibly damaging 0.81
R1735:Rtn3 UTSW 19 7457911 missense probably damaging 0.96
R2093:Rtn3 UTSW 19 7456850 missense probably damaging 1.00
R3116:Rtn3 UTSW 19 7431990 missense probably damaging 1.00
R3894:Rtn3 UTSW 19 7435085 missense probably damaging 1.00
R3961:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R3962:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R3963:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R4161:Rtn3 UTSW 19 7483079 missense probably benign 0.38
R4960:Rtn3 UTSW 19 7456521 missense probably damaging 1.00
R5585:Rtn3 UTSW 19 7458195 missense probably benign 0.12
R5735:Rtn3 UTSW 19 7456692 missense probably damaging 0.99
R5796:Rtn3 UTSW 19 7457467 missense possibly damaging 0.48
R5807:Rtn3 UTSW 19 7456827 missense probably damaging 1.00
R5864:Rtn3 UTSW 19 7435111 missense probably damaging 1.00
R6322:Rtn3 UTSW 19 7458138 missense possibly damaging 0.60
R6703:Rtn3 UTSW 19 7435045 missense probably damaging 1.00
R6885:Rtn3 UTSW 19 7458331 missense probably benign 0.31
R6888:Rtn3 UTSW 19 7457249 missense probably benign 0.00
R6989:Rtn3 UTSW 19 7456491 missense possibly damaging 0.95
X0060:Rtn3 UTSW 19 7432571 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACTTGAATGGATGTCCTTCTTCTGAC -3'
(R):5'- TGTCACAGGCCTACAATCCC -3'

Sequencing Primer
(F):5'- GACTTCTGCACAGCTTGAATGACAG -3'
(R):5'- ATCCCAGCTCGTAGGAGATCAG -3'
Posted On2019-05-13