Incidental Mutation 'R6993:Ppp1r12a'
ID543981
Institutional Source Beutler Lab
Gene Symbol Ppp1r12a
Ensembl Gene ENSMUSG00000019907
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12A
Synonyms1200015F06Rik, 5730577I22Rik, Mypt1, D10Ertd625e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6993 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location108162193-108284475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108240837 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 309 (E309G)
Ref Sequence ENSEMBL: ENSMUSP00000151842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070663] [ENSMUST00000219263]
Predicted Effect probably benign
Transcript: ENSMUST00000070663
AA Change: E309G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000069257
Gene: ENSMUSG00000019907
AA Change: E309G

DomainStartEndE-ValueType
ANK 38 68 1.01e2 SMART
ANK 72 101 1.66e-6 SMART
ANK 105 134 6.36e-3 SMART
ANK 138 168 5.52e2 SMART
ANK 198 227 6.12e-5 SMART
ANK 231 260 5.16e-3 SMART
coiled coil region 333 354 N/A INTRINSIC
low complexity region 385 402 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
low complexity region 626 656 N/A INTRINSIC
PDB:2KJY|A 657 712 5e-12 PDB
low complexity region 719 745 N/A INTRINSIC
low complexity region 771 794 N/A INTRINSIC
low complexity region 815 833 N/A INTRINSIC
low complexity region 836 851 N/A INTRINSIC
low complexity region 883 902 N/A INTRINSIC
Pfam:PRKG1_interact 930 993 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219263
AA Change: E309G

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin phosphatase target subunit 1, which is also called the myosin-binding subunit of myosin phosphatase, is one of the subunits of myosin phosphatase. Myosin phosphatase regulates the interaction of actin and myosin downstream of the guanosine triphosphatase Rho. The small guanosine triphosphatase Rho is implicated in myosin light chain (MLC) phosphorylation, which results in contraction of smooth muscle and interaction of actin and myosin in nonmuscle cells. The guanosine triphosphate (GTP)-bound, active form of RhoA (GTP.RhoA) specifically interacted with the myosin-binding subunit (MBS) of myosin phosphatase, which regulates the extent of phosphorylation of MLC. Rho-associated kinase (Rho-kinase), which is activated by GTP. RhoA, phosphorylated MBS and consequently inactivated myosin phosphatase. Overexpression of RhoA or activated RhoA in NIH 3T3 cells increased phosphorylation of MBS and MLC. Thus, Rho appears to inhibit myosin phosphatase through the action of Rho-kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous null mice die before E7.5. Mice homozygous for a floxed allele activated in smooth muscle exhibit altered intestinal smooth muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,248,424 E10G possibly damaging Het
Akap9 A G 5: 4,065,866 I3429V possibly damaging Het
Braf T A 6: 39,643,163 I441F probably damaging Het
C5ar1 A T 7: 16,248,912 V61E probably damaging Het
Camk2a C A 18: 60,943,175 probably benign Het
Cd163 A G 6: 124,317,714 Y579C probably damaging Het
Celf1 T C 2: 91,010,476 Y363H probably damaging Het
Cntn3 T C 6: 102,278,404 T178A probably damaging Het
Cryab C T 9: 50,753,448 P58S probably benign Het
Ctsf G T 19: 4,858,483 R290L probably benign Het
Ctsw T A 19: 5,465,837 I258F probably damaging Het
Dnah7b T C 1: 46,195,139 probably null Het
Drg1 TCATCTTCCA TCA 11: 3,250,294 probably null Het
Etfb A G 7: 43,456,554 T172A possibly damaging Het
Etfdh A G 3: 79,612,031 Y272H probably benign Het
Ewsr1 C T 11: 5,071,573 R454Q probably benign Het
F2rl2 T A 13: 95,701,134 I229N probably damaging Het
Fam162a A T 16: 36,049,845 I88N probably damaging Het
Fastkd5 A G 2: 130,616,539 S44P probably benign Het
Fat3 T G 9: 15,919,221 S4326R probably damaging Het
Fbf1 T C 11: 116,152,784 K400E probably benign Het
Fndc7 A G 3: 108,876,591 V234A probably benign Het
Gfi1 T A 5: 107,717,768 H481L probably damaging Het
Gm5591 T A 7: 38,519,223 H742L probably benign Het
Gm5724 G A 6: 141,765,742 T81I possibly damaging Het
Gm853 A G 4: 130,218,313 L192P probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
H2-DMb1 A C 17: 34,157,350 T148P possibly damaging Het
H2-T3 A G 17: 36,187,070 L317P probably damaging Het
Hes3 T C 4: 152,286,923 T190A probably benign Het
Hivep1 C T 13: 42,158,714 L1477F possibly damaging Het
Insr C T 8: 3,258,752 G95S probably damaging Het
Irf9 A G 14: 55,608,957 I394V probably benign Het
Kat2b T C 17: 53,638,522 L323P probably damaging Het
Kdr T C 5: 75,972,411 D69G probably benign Het
Krt2 C T 15: 101,815,960 E290K probably damaging Het
Krtap4-6 G T 11: 99,665,719 R61S unknown Het
Lrrc27 A T 7: 139,242,624 K477M probably damaging Het
Lvrn T C 18: 46,882,298 V579A probably benign Het
Malrd1 A T 2: 16,150,791 I2004L unknown Het
Mast4 A T 13: 102,735,974 N2103K probably benign Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Myo18a T A 11: 77,859,074 probably benign Het
Olfr597 G T 7: 103,320,791 probably benign Het
Olfr975 T A 9: 39,950,637 M45L probably benign Het
Pcdhga10 A G 18: 37,749,256 Y690C probably damaging Het
Pdcd2 A G 17: 15,527,081 Y65H probably damaging Het
Psmb8 A G 17: 34,199,643 D123G probably damaging Het
Ptcd3 A T 6: 71,885,315 W513R probably damaging Het
Ptx4 G A 17: 25,124,924 V383I possibly damaging Het
Ric1 T C 19: 29,586,613 L589S probably damaging Het
Rmnd5b A G 11: 51,624,600 probably benign Het
Sec16a A T 2: 26,423,574 S1925T probably damaging Het
Slc16a11 T A 11: 70,216,016 M360K possibly damaging Het
Slc19a2 T A 1: 164,260,822 F79I probably benign Het
Slc2a6 G T 2: 27,027,243 S45R probably damaging Het
Sppl3 T A 5: 115,082,290 M87K probably damaging Het
Tbcel A T 9: 42,416,117 L330* probably null Het
Tbx5 A T 5: 119,871,389 Y321F possibly damaging Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Unc45a A T 7: 80,325,655 Y934N probably damaging Het
Unc80 A T 1: 66,549,793 Q1039L possibly damaging Het
Vmn2r112 T C 17: 22,603,214 L291P probably benign Het
Wwc2 A T 8: 47,847,465 F988I unknown Het
Zfp947 G A 17: 22,145,980 P238S probably benign Het
Other mutations in Ppp1r12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ppp1r12a APN 10 108198848 missense probably damaging 1.00
IGL00727:Ppp1r12a APN 10 108230473 missense probably damaging 1.00
IGL00819:Ppp1r12a APN 10 108240821 missense probably damaging 0.98
IGL01538:Ppp1r12a APN 10 108234021 missense probably damaging 1.00
IGL02227:Ppp1r12a APN 10 108269324 missense probably damaging 1.00
IGL02957:Ppp1r12a APN 10 108198918 missense probably damaging 0.98
IGL03063:Ppp1r12a APN 10 108261254 missense probably damaging 1.00
IGL03260:Ppp1r12a APN 10 108261245 missense probably benign 0.10
R0049:Ppp1r12a UTSW 10 108253332 missense possibly damaging 0.63
R0268:Ppp1r12a UTSW 10 108273381 intron probably benign
R0826:Ppp1r12a UTSW 10 108230553 missense possibly damaging 0.46
R0839:Ppp1r12a UTSW 10 108198861 missense probably damaging 1.00
R1026:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1053:Ppp1r12a UTSW 10 108262351 missense probably damaging 1.00
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1511:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1616:Ppp1r12a UTSW 10 108260867 missense probably damaging 1.00
R1673:Ppp1r12a UTSW 10 108249565 missense probably damaging 0.96
R1866:Ppp1r12a UTSW 10 108262431 missense possibly damaging 0.85
R1901:Ppp1r12a UTSW 10 108198891 missense probably damaging 1.00
R1902:Ppp1r12a UTSW 10 108198891 missense probably damaging 1.00
R2233:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R2234:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R3760:Ppp1r12a UTSW 10 108264734 missense probably damaging 1.00
R3856:Ppp1r12a UTSW 10 108253501 intron probably benign
R3973:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3974:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3976:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R4502:Ppp1r12a UTSW 10 108249478 missense probably benign 0.26
R4902:Ppp1r12a UTSW 10 108230590 missense probably damaging 1.00
R5092:Ppp1r12a UTSW 10 108267402 critical splice acceptor site probably null
R5224:Ppp1r12a UTSW 10 108261025 missense probably benign 0.37
R5353:Ppp1r12a UTSW 10 108261216 intron probably null
R5428:Ppp1r12a UTSW 10 108253347 missense possibly damaging 0.76
R5472:Ppp1r12a UTSW 10 108240112 missense probably damaging 1.00
R5510:Ppp1r12a UTSW 10 108249627 missense possibly damaging 0.82
R6217:Ppp1r12a UTSW 10 108240184 splice site probably null
R6274:Ppp1r12a UTSW 10 108260890 missense probably benign 0.00
R6431:Ppp1r12a UTSW 10 108262420 missense probably damaging 1.00
R6744:Ppp1r12a UTSW 10 108230534 missense probably damaging 1.00
R6838:Ppp1r12a UTSW 10 108261276 missense possibly damaging 0.76
R6865:Ppp1r12a UTSW 10 108262381 nonsense probably null
X0027:Ppp1r12a UTSW 10 108214423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTGTTGTTTACAAATTGCCAAG -3'
(R):5'- ATCAACGTTTCCTTGCTGCG -3'

Sequencing Primer
(F):5'- CAAATTGCCAAGTGTTTTTCAAGC -3'
(R):5'- GCATTAACCCGTTCATAACAGTGAG -3'
Posted On2019-05-13