Mutagenetix > Incidental Mutation

Incidental Mutation 'R6994:Pikfyve'

544013

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

PipkIII, Pip5k3, 5230400C17Rik

MMRRC Submission

045100-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6994 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65225842-65317854 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 65291689 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 1303 (P1303T)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

probably damaging
Transcript: ENSMUST00000081154
AA Change: P1258T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: P1258T

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097707
AA Change: P1303T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: P1303T

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Meta Mutation Damage Score

0.0871

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	T	G	4: 144,349,849 (GRCm39)	W369G	probably damaging	Het
Abhd16b	C	T	2: 181,135,461 (GRCm39)	T121M	possibly damaging	Het
Adam5	A	T	8: 25,276,262 (GRCm39)	C468*	probably null	Het
Aim2	C	T	1: 173,283,152 (GRCm39)	A78V	possibly damaging	Het
Alg9	G	A	9: 50,703,422 (GRCm39)	W254*	probably null	Het
Ankrd55	G	C	13: 112,504,834 (GRCm39)	E499Q	probably benign	Het
Atp6v0a2	T	C	5: 124,791,209 (GRCm39)	F546S	probably damaging	Het
Bean1	CT	C	8: 104,908,664 (GRCm39)		probably null	Het
Bpi	A	T	2: 158,100,164 (GRCm39)		probably benign	Het
Bves	A	G	10: 45,215,514 (GRCm39)	H63R	probably benign	Het
Ccdc183	T	C	2: 25,507,057 (GRCm39)	M45V	probably benign	Het
Cfhr4	T	A	1: 139,664,668 (GRCm39)	I464L	possibly damaging	Het
Cmklr1	T	C	5: 113,752,983 (GRCm39)	Y6C	probably damaging	Het
Colgalt1	C	T	8: 72,076,165 (GRCm39)	R539C	probably damaging	Het
Ctsm	T	A	13: 61,687,698 (GRCm39)	E53D	probably damaging	Het
Cyp2a22	A	G	7: 26,638,606 (GRCm39)		probably null	Het
Ddx10	A	G	9: 53,115,411 (GRCm39)	V641A	probably damaging	Het
Ddx6	T	C	9: 44,540,020 (GRCm39)	V316A	probably damaging	Het
Dhx34	T	C	7: 15,937,799 (GRCm39)	D767G	probably benign	Het
Dnaaf6rt	T	C	1: 31,261,990 (GRCm39)		probably benign	Het
Dtnbp1	T	A	13: 45,155,405 (GRCm39)	D15V	probably damaging	Het
Dtx3l	C	T	16: 35,751,742 (GRCm39)		probably null	Het
Entpd8	T	C	2: 24,973,321 (GRCm39)	I162T	probably damaging	Het
Fam186a	G	T	15: 99,840,347 (GRCm39)	Q1966K	probably benign	Het
Fbxo27	A	C	7: 28,392,785 (GRCm39)	D22A	probably damaging	Het
Fermt3	A	T	19: 6,977,095 (GRCm39)	I577N	probably damaging	Het
Frmd8	A	T	19: 5,923,209 (GRCm39)	S81T	probably damaging	Het
Gm5108	T	A	5: 68,102,012 (GRCm39)		probably benign	Het
Gm9195	T	C	14: 72,718,271 (GRCm39)	Y135C	probably damaging	Het
Gpatch2l	G	A	12: 86,290,958 (GRCm39)	R47H	probably damaging	Het
Kcnh8	A	T	17: 53,284,723 (GRCm39)	I898F	probably benign	Het
Kri1	C	T	9: 21,199,083 (GRCm39)		probably benign	Het
Krt32	T	A	11: 99,977,271 (GRCm39)	I210F	probably damaging	Het
Lama1	G	A	17: 68,060,820 (GRCm39)	C716Y		Het
Lamc2	G	A	1: 153,012,508 (GRCm39)	T722M	probably benign	Het
Lpin3	C	T	2: 160,746,803 (GRCm39)	P766L	probably damaging	Het
Macroh2a1	T	C	13: 56,237,643 (GRCm39)	N206D	probably benign	Het
Marf1	T	C	16: 13,946,721 (GRCm39)	T1169A	probably damaging	Het
Morc1	G	A	16: 48,385,984 (GRCm39)	V536M	probably benign	Het
Morc1	A	T	16: 48,438,909 (GRCm39)	H768L	probably benign	Het
Mpped2	T	A	2: 106,529,878 (GRCm39)	H42Q	possibly damaging	Het
Nfatc1	G	T	18: 80,696,779 (GRCm39)		probably null	Het
Nfkbid	G	A	7: 30,125,192 (GRCm39)	S263N	probably benign	Het
Npas3	C	A	12: 54,115,576 (GRCm39)	Q802K	probably damaging	Het
Or52s1b	T	C	7: 102,822,119 (GRCm39)	T242A	probably damaging	Het
Or5ac20	T	G	16: 59,104,453 (GRCm39)	M136L	possibly damaging	Het
Or5p67	T	A	7: 107,922,101 (GRCm39)	I261F	possibly damaging	Het
Pabpc4l	C	A	3: 46,401,345 (GRCm39)	V100L	possibly damaging	Het
Pagr1a	A	G	7: 126,615,613 (GRCm39)		probably null	Het
Pcdh1	A	T	18: 38,331,553 (GRCm39)	N483K	probably damaging	Het
Plekhh3	T	A	11: 101,056,519 (GRCm39)		probably null	Het
Pnkd	T	A	1: 74,332,335 (GRCm39)		probably null	Het
Pparg	A	T	6: 115,428,011 (GRCm39)	Q166L	probably benign	Het
Psenen	A	G	7: 30,262,932 (GRCm39)		probably null	Het
Rab4a	T	C	8: 124,557,105 (GRCm39)	S142P	probably damaging	Het
Reg3a	T	C	6: 78,358,132 (GRCm39)	V21A	probably benign	Het
Relt	A	C	7: 100,502,321 (GRCm39)		probably benign	Het
Rftn1	T	A	17: 50,344,019 (GRCm39)	T90S	possibly damaging	Het
Ripor3	T	G	2: 167,839,186 (GRCm39)	D105A	probably damaging	Het
Rnase10	T	A	14: 51,247,138 (GRCm39)	I135N	probably damaging	Het
Rsrc1	C	T	3: 66,901,982 (GRCm39)	P44L	unknown	Het
Rttn	A	G	18: 89,047,023 (GRCm39)	E895G	probably damaging	Het
Serpina3a	G	A	12: 104,079,089 (GRCm39)		probably null	Het
Slco5a1	C	T	1: 12,951,617 (GRCm39)	C562Y	probably damaging	Het
Spen	T	C	4: 141,220,770 (GRCm39)	T396A	unknown	Het
Tgfbr3	A	G	5: 107,280,892 (GRCm39)	S623P	probably damaging	Het
Tmem8b	A	G	4: 43,690,192 (GRCm39)	I876V	probably damaging	Het
Tmod3	T	C	9: 75,416,669 (GRCm39)	K221R	probably damaging	Het
Tomm40	G	T	7: 19,436,831 (GRCm39)	D40E	probably damaging	Het
Trav6d-4	G	T	14: 52,991,048 (GRCm39)	G28V	probably damaging	Het
Trav8d-2	G	T	14: 53,279,933 (GRCm39)	A17S	probably benign	Het
Triml2	T	C	8: 43,643,115 (GRCm39)	C158R	possibly damaging	Het
Trip10	A	G	17: 57,562,331 (GRCm39)	E283G	probably damaging	Het
Tubb2b	T	C	13: 34,311,518 (GRCm39)	Y425C	probably damaging	Het
Ubr1	T	C	2: 120,794,074 (GRCm39)	T37A	probably benign	Het
Unc13b	A	G	4: 43,171,403 (GRCm39)		probably benign	Het
Unc13b	A	G	4: 43,173,203 (GRCm39)		probably benign	Het
Vcan	A	T	13: 89,841,526 (GRCm39)	D379E	possibly damaging	Het
Vmn1r44	T	A	6: 89,871,140 (GRCm39)	H295Q	probably benign	Het
Vmn2r16	A	T	5: 109,487,969 (GRCm39)	S281C	probably damaging	Het
Vmn2r84	C	T	10: 130,226,876 (GRCm39)	A321T	possibly damaging	Het
Vsig10l	A	T	7: 43,114,491 (GRCm39)	H271L	possibly damaging	Het
Vwa8	A	T	14: 79,145,596 (GRCm39)	H91L	possibly damaging	Het
Zfp957	T	A	14: 79,451,130 (GRCm39)	E223V	probably damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65,299,280 (GRCm39)	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65,290,794 (GRCm39)	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65,298,028 (GRCm39)	nonsense	probably null
IGL01759:Pikfyve	APN	1	65,292,512 (GRCm39)	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65,262,799 (GRCm39)	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65,303,524 (GRCm39)	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65,277,703 (GRCm39)	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65,285,556 (GRCm39)	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65,290,837 (GRCm39)	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65,295,180 (GRCm39)	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65,291,728 (GRCm39)	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65,283,663 (GRCm39)	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65,290,771 (GRCm39)	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65,303,535 (GRCm39)	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65,270,014 (GRCm39)	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65,273,431 (GRCm39)	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65,289,353 (GRCm39)	nonsense	probably null
IGL02890:Pikfyve	APN	1	65,269,956 (GRCm39)	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65,291,626 (GRCm39)	nonsense	probably null
IGL03294:Pikfyve	APN	1	65,286,226 (GRCm39)	missense	probably damaging	1.00
falcon	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
oompa	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
wonka	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65,242,075 (GRCm39)	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65,255,088 (GRCm39)	splice site	probably benign
R0196:Pikfyve	UTSW	1	65,295,231 (GRCm39)	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65,302,064 (GRCm39)	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65,285,490 (GRCm39)	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65,303,558 (GRCm39)	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65,259,058 (GRCm39)	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65,292,682 (GRCm39)	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65,292,556 (GRCm39)	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65,304,983 (GRCm39)	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65,286,118 (GRCm39)	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65,310,470 (GRCm39)	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65,263,360 (GRCm39)	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65,302,136 (GRCm39)	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65,304,443 (GRCm39)	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65,291,707 (GRCm39)	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65,285,529 (GRCm39)	missense	probably benign
R1773:Pikfyve	UTSW	1	65,231,430 (GRCm39)	missense	probably damaging	0.99
R1795:Pikfyve	UTSW	1	65,291,716 (GRCm39)	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65,297,957 (GRCm39)	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65,231,454 (GRCm39)	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65,285,867 (GRCm39)	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65,261,516 (GRCm39)	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65,292,512 (GRCm39)	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65,307,014 (GRCm39)	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65,285,835 (GRCm39)	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65,292,676 (GRCm39)	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65,284,917 (GRCm39)	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65,283,579 (GRCm39)	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65,270,004 (GRCm39)	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65,235,840 (GRCm39)	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65,229,679 (GRCm39)	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65,283,589 (GRCm39)	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65,231,351 (GRCm39)	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65,273,421 (GRCm39)	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4716:Pikfyve	UTSW	1	65,285,635 (GRCm39)	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65,311,674 (GRCm39)	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4785:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4805:Pikfyve	UTSW	1	65,307,959 (GRCm39)	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65,285,749 (GRCm39)	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65,263,276 (GRCm39)	intron	probably benign
R5265:Pikfyve	UTSW	1	65,306,988 (GRCm39)	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65,235,858 (GRCm39)	nonsense	probably null
R5384:Pikfyve	UTSW	1	65,283,568 (GRCm39)	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65,304,427 (GRCm39)	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65,274,192 (GRCm39)	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65,291,654 (GRCm39)	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65,312,889 (GRCm39)	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65,295,247 (GRCm39)	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65,255,187 (GRCm39)	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65,241,896 (GRCm39)	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65,292,597 (GRCm39)	nonsense	probably null
R6026:Pikfyve	UTSW	1	65,311,856 (GRCm39)	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65,255,202 (GRCm39)	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65,292,691 (GRCm39)	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65,242,084 (GRCm39)	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65,302,112 (GRCm39)	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65,304,940 (GRCm39)	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65,298,002 (GRCm39)	missense	probably damaging	0.98
R6997:Pikfyve	UTSW	1	65,285,822 (GRCm39)	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65,273,520 (GRCm39)	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65,286,013 (GRCm39)	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65,286,364 (GRCm39)	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65,283,585 (GRCm39)	nonsense	probably null
R7558:Pikfyve	UTSW	1	65,311,782 (GRCm39)	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65,307,036 (GRCm39)	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65,309,101 (GRCm39)	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65,304,948 (GRCm39)	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65,285,554 (GRCm39)	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65,292,501 (GRCm39)	splice site	probably benign
R8307:Pikfyve	UTSW	1	65,284,894 (GRCm39)	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65,255,155 (GRCm39)	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65,283,576 (GRCm39)	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65,310,427 (GRCm39)	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65,286,129 (GRCm39)	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65,244,746 (GRCm39)	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65,283,559 (GRCm39)	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65,285,239 (GRCm39)	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65,235,898 (GRCm39)	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65,299,188 (GRCm39)	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65,307,901 (GRCm39)	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9605:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9686:Pikfyve	UTSW	1	65,291,615 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTATTCTAGAGCTGCTGCCG -3'
(R):5'- TAGCACAAGGTTATACGAAGATCAC -3'

Sequencing Primer
(F):5'- AGAGCTGCTGCCGTACTTTC -3'
(R):5'- AGGTTATACGAAGATCACAACAAC -3'

Posted On

2019-05-13