Incidental Mutation 'R0608:Zfp788'
ID54403
Institutional Source Beutler Lab
Gene Symbol Zfp788
Ensembl Gene ENSMUSG00000074165
Gene Namezinc finger protein 788
Synonyms
MMRRC Submission 038797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0608 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location41633203-41651530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41648281 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 62 (F62I)
Ref Sequence ENSEMBL: ENSMUSP00000132848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045720] [ENSMUST00000098508] [ENSMUST00000100275] [ENSMUST00000131180] [ENSMUST00000140964] [ENSMUST00000154942] [ENSMUST00000170770]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045720
AA Change: F94I

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035499
Gene: ENSMUSG00000074165
AA Change: F94I

DomainStartEndE-ValueType
KRAB 4 67 7.82e-17 SMART
ZnF_C2H2 218 240 2.53e-2 SMART
ZnF_C2H2 246 268 2.71e-2 SMART
ZnF_C2H2 274 296 8.47e-4 SMART
ZnF_C2H2 302 324 3.16e-3 SMART
ZnF_C2H2 330 352 1.38e-3 SMART
ZnF_C2H2 358 380 4.54e-4 SMART
ZnF_C2H2 386 408 1.36e-2 SMART
ZnF_C2H2 414 436 2.24e-3 SMART
ZnF_C2H2 442 464 5.14e-3 SMART
ZnF_C2H2 470 492 5.14e-3 SMART
ZnF_C2H2 498 520 5.42e-2 SMART
ZnF_C2H2 526 548 8.6e-5 SMART
ZnF_C2H2 554 576 1.53e-1 SMART
ZnF_C2H2 582 604 2.4e-3 SMART
ZnF_C2H2 610 632 8.81e-2 SMART
ZnF_C2H2 638 660 9.58e-3 SMART
ZnF_C2H2 666 688 4.54e-4 SMART
ZnF_C2H2 694 716 1.1e-2 SMART
ZnF_C2H2 722 744 3.63e-3 SMART
ZnF_C2H2 750 772 8.94e-3 SMART
ZnF_C2H2 778 800 1.5e-4 SMART
ZnF_C2H2 806 828 4.24e-4 SMART
ZnF_C2H2 834 856 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098508
AA Change: F114I

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096108
Gene: ENSMUSG00000074165
AA Change: F114I

DomainStartEndE-ValueType
KRAB 24 87 7.82e-17 SMART
ZnF_C2H2 238 260 2.53e-2 SMART
ZnF_C2H2 266 288 2.71e-2 SMART
ZnF_C2H2 294 316 8.47e-4 SMART
ZnF_C2H2 322 344 3.16e-3 SMART
ZnF_C2H2 350 372 1.38e-3 SMART
ZnF_C2H2 378 400 4.54e-4 SMART
ZnF_C2H2 406 428 1.36e-2 SMART
ZnF_C2H2 434 456 2.24e-3 SMART
ZnF_C2H2 462 484 5.14e-3 SMART
ZnF_C2H2 490 512 5.14e-3 SMART
ZnF_C2H2 518 540 5.42e-2 SMART
ZnF_C2H2 546 568 8.6e-5 SMART
ZnF_C2H2 574 596 1.53e-1 SMART
ZnF_C2H2 602 624 2.4e-3 SMART
ZnF_C2H2 630 652 8.81e-2 SMART
ZnF_C2H2 658 680 9.58e-3 SMART
ZnF_C2H2 686 708 4.54e-4 SMART
ZnF_C2H2 714 736 1.1e-2 SMART
ZnF_C2H2 742 764 3.63e-3 SMART
ZnF_C2H2 770 792 8.94e-3 SMART
ZnF_C2H2 798 820 1.5e-4 SMART
ZnF_C2H2 826 848 4.24e-4 SMART
ZnF_C2H2 854 876 5.06e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100275
AA Change: F62I

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097847
Gene: ENSMUSG00000074165
AA Change: F62I

DomainStartEndE-ValueType
Blast:KRAB 1 35 1e-16 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.38e-3 SMART
ZnF_C2H2 326 348 4.54e-4 SMART
ZnF_C2H2 354 376 1.36e-2 SMART
ZnF_C2H2 382 404 2.24e-3 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 5.14e-3 SMART
ZnF_C2H2 466 488 5.42e-2 SMART
ZnF_C2H2 494 516 8.6e-5 SMART
ZnF_C2H2 522 544 1.53e-1 SMART
ZnF_C2H2 550 572 2.4e-3 SMART
ZnF_C2H2 578 600 8.81e-2 SMART
ZnF_C2H2 606 628 9.58e-3 SMART
ZnF_C2H2 634 656 4.54e-4 SMART
ZnF_C2H2 662 684 1.1e-2 SMART
ZnF_C2H2 690 712 3.63e-3 SMART
ZnF_C2H2 718 740 8.94e-3 SMART
ZnF_C2H2 746 768 1.5e-4 SMART
ZnF_C2H2 774 796 4.24e-4 SMART
ZnF_C2H2 802 824 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131180
AA Change: F114I

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114542
Gene: ENSMUSG00000074165
AA Change: F114I

DomainStartEndE-ValueType
KRAB 24 87 7.82e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140964
AA Change: F62I

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116050
Gene: ENSMUSG00000074165
AA Change: F62I

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-17 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154942
Predicted Effect possibly damaging
Transcript: ENSMUST00000170770
AA Change: F62I

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132848
Gene: ENSMUSG00000074165
AA Change: F62I

DomainStartEndE-ValueType
Blast:KRAB 1 35 1e-16 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.38e-3 SMART
ZnF_C2H2 326 348 4.54e-4 SMART
ZnF_C2H2 354 376 1.36e-2 SMART
ZnF_C2H2 382 404 2.24e-3 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 5.14e-3 SMART
ZnF_C2H2 466 488 5.42e-2 SMART
ZnF_C2H2 494 516 8.6e-5 SMART
ZnF_C2H2 522 544 1.53e-1 SMART
ZnF_C2H2 550 572 2.4e-3 SMART
ZnF_C2H2 578 600 8.81e-2 SMART
ZnF_C2H2 606 628 9.58e-3 SMART
ZnF_C2H2 634 656 4.54e-4 SMART
ZnF_C2H2 662 684 1.1e-2 SMART
ZnF_C2H2 690 712 3.63e-3 SMART
ZnF_C2H2 718 740 8.94e-3 SMART
ZnF_C2H2 746 768 1.5e-4 SMART
ZnF_C2H2 774 796 4.24e-4 SMART
ZnF_C2H2 802 824 5.06e-2 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ampd3 C A 7: 110,795,790 D315E probably damaging Het
Ampd3 T A 7: 110,795,791 F316I probably damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atxn2l A G 7: 126,501,416 probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Bckdhb T G 9: 83,953,736 F98V probably damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Ccdc28a G A 10: 18,224,951 R90C probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cep128 T G 12: 90,999,535 probably benign Het
Cep72 A T 13: 74,038,304 H249Q probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Col11a1 T C 3: 114,218,715 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah17 G T 11: 118,090,749 Y1716* probably null Het
Dnm1 T C 2: 32,335,824 E383G possibly damaging Het
Dst C A 1: 34,290,356 probably null Het
Edil3 T C 13: 89,184,849 S375P probably damaging Het
Eme1 A G 11: 94,650,082 C277R probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Fbxl6 C T 15: 76,536,753 V341M probably benign Het
Fgf14 A G 14: 124,676,603 S39P probably damaging Het
Fmo4 C T 1: 162,803,651 R249H possibly damaging Het
Gle1 T A 2: 29,940,228 D265E probably benign Het
Gml2 T C 15: 74,821,386 probably null Het
Golgb1 G T 16: 36,916,330 E1980* probably null Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Heca T C 10: 17,915,291 D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 T101A possibly damaging Het
Ift88 T C 14: 57,496,221 V707A probably benign Het
Kdm3a C T 6: 71,620,046 G252D probably benign Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Kntc1 A T 5: 123,786,074 N1008Y probably damaging Het
Lrp2 G T 2: 69,486,243 N2131K probably benign Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magi3 C G 3: 104,017,557 G1092A probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrps26 G T 2: 130,563,858 R27L possibly damaging Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Naif1 T C 2: 32,454,896 M204T probably benign Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Neb A T 2: 52,326,757 D135E probably benign Het
Nlrp6 C T 7: 140,923,486 Q502* probably null Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Pnpla8 C T 12: 44,283,463 P48L probably benign Het
Rab44 T A 17: 29,147,343 probably null Het
Ranbp2 T C 10: 58,493,898 I3031T probably damaging Het
Rnf219 T C 14: 104,479,527 Y470C probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Serpinh1 A G 7: 99,349,394 C10R unknown Het
Sh2d4a A G 8: 68,346,694 Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spire1 T C 18: 67,528,875 R163G probably damaging Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Susd2 C T 10: 75,638,235 A509T probably benign Het
Sycp2 A G 2: 178,382,404 F396L probably damaging Het
Syne2 T C 12: 75,963,813 L2499P probably damaging Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tab2 C T 10: 7,920,119 V126I probably damaging Het
Tecpr1 T C 5: 144,211,499 T363A probably damaging Het
Terb2 A G 2: 122,186,335 D16G probably benign Het
Tm2d2 A G 8: 25,020,536 E137G probably benign Het
Trim30d T A 7: 104,472,485 H201L probably damaging Het
Tspan3 A G 9: 56,147,385 probably null Het
Ttn A T 2: 76,787,323 L16268Q probably damaging Het
Ttn A T 2: 76,796,185 probably null Het
Ubap2 T A 4: 41,218,319 T263S probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zeb2 A T 2: 44,996,126 M973K possibly damaging Het
Zfp229 A G 17: 21,746,634 E615G probably damaging Het
Zfp655 T A 5: 145,244,057 S242T possibly damaging Het
Zmynd8 A G 2: 165,787,158 probably null Het
Other mutations in Zfp788
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0207:Zfp788 UTSW 7 41649596 missense probably damaging 1.00
R0320:Zfp788 UTSW 7 41649547 missense probably damaging 1.00
R1184:Zfp788 UTSW 7 41648326 missense probably damaging 1.00
R1483:Zfp788 UTSW 7 41649075 nonsense probably null
R1985:Zfp788 UTSW 7 41650481 missense probably damaging 0.98
R2030:Zfp788 UTSW 7 41649560 missense probably damaging 1.00
R2207:Zfp788 UTSW 7 41649640 missense probably damaging 0.99
R2313:Zfp788 UTSW 7 41648888 missense probably damaging 0.99
R3791:Zfp788 UTSW 7 41649728 missense probably damaging 0.99
R3872:Zfp788 UTSW 7 41649444 nonsense probably null
R4126:Zfp788 UTSW 7 41649436 missense probably damaging 0.97
R4579:Zfp788 UTSW 7 41647594 missense probably benign 0.00
R4833:Zfp788 UTSW 7 41647568 missense probably benign 0.31
R5076:Zfp788 UTSW 7 41648584 missense possibly damaging 0.93
R5175:Zfp788 UTSW 7 41649329 missense probably damaging 1.00
R5225:Zfp788 UTSW 7 41649556 missense probably benign 0.16
R5364:Zfp788 UTSW 7 41650127 missense probably damaging 1.00
R5427:Zfp788 UTSW 7 41649652 missense possibly damaging 0.82
R5484:Zfp788 UTSW 7 41649853 missense probably damaging 0.96
R5659:Zfp788 UTSW 7 41650116 nonsense probably null
R5917:Zfp788 UTSW 7 41649148 missense probably benign
R6064:Zfp788 UTSW 7 41648454 missense probably benign 0.18
R6128:Zfp788 UTSW 7 41650361 missense probably damaging 1.00
R6144:Zfp788 UTSW 7 41649769 missense probably damaging 0.97
R6182:Zfp788 UTSW 7 41650516 missense probably damaging 0.98
R6299:Zfp788 UTSW 7 41648541 missense possibly damaging 0.81
R6823:Zfp788 UTSW 7 41649560 missense probably damaging 1.00
R6974:Zfp788 UTSW 7 41649877 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGGGAACCACATCAGAAAATCACAAG -3'
(R):5'- TGTGGCACAAACGTTATAAGACCTACTC -3'

Sequencing Primer
(F):5'- TGATTGCAAACCATTCACCTG -3'
(R):5'- GACCTACTCATACTGAGATTTTGTG -3'
Posted On2013-07-11