Incidental Mutation 'R6996:Mme'
ID544187
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Namemembrane metallo endopeptidase
SynonymsCD10, neprilysin, NEP, neutral endopeptidase, 6030454K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6996 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location63241537-63386030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63346102 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 456 (D456N)
Ref Sequence ENSEMBL: ENSMUSP00000141544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000194134] [ENSMUST00000194150]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029400
AA Change: D456N

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: D456N

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194134
AA Change: D456N

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: D456N

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194150
AA Change: D456N

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: D456N

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 G A 8: 24,806,501 S310L probably damaging Het
Adamts16 C T 13: 70,798,038 probably null Het
Arrb1 C A 7: 99,591,362 D194E probably benign Het
Atp1a3 T C 7: 24,997,626 D217G probably damaging Het
Bcar3 A G 3: 122,508,384 I123V possibly damaging Het
Bdp1 G A 13: 100,043,813 L1833F probably damaging Het
Cdc14a T C 3: 116,328,706 Y155C probably damaging Het
Cdo1 C A 18: 46,720,313 R126M possibly damaging Het
Cfap99 G T 5: 34,327,260 R627L probably damaging Het
Efr3a T A 15: 65,848,181 L369* probably null Het
Erich6 A C 3: 58,636,095 F185V probably damaging Het
Fam186a T C 15: 99,955,493 D122G unknown Het
Fank1 A G 7: 133,876,898 I230M possibly damaging Het
Flg2 A T 3: 93,202,670 E668D unknown Het
Flg2 A C 3: 93,202,949 R761S unknown Het
Gabrr1 T C 4: 33,158,157 L260P probably damaging Het
Gfm2 G A 13: 97,149,360 R119K probably damaging Het
Gm14226 A G 2: 155,024,437 T105A probably benign Het
Gm14496 A G 2: 181,996,204 N357S probably damaging Het
Gm5916 G A 9: 36,128,639 L18F probably benign Het
Gm884 A T 11: 103,618,757 L795* probably null Het
Golm1 A T 13: 59,642,244 N247K probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Greb1 C T 12: 16,723,354 A240T probably benign Het
Gtf3c6 T C 10: 40,249,778 M148V probably benign Het
Guca1a T C 17: 47,395,177 S126G probably benign Het
Hacl1 A T 14: 31,615,423 I393N possibly damaging Het
Hddc3 A G 7: 80,343,750 D68G possibly damaging Het
Hsfy2 T C 1: 56,636,410 T323A possibly damaging Het
Kcng2 T C 18: 80,323,143 probably benign Het
Kdm2a G T 19: 4,345,641 P321T probably benign Het
Krt31 A G 11: 100,047,732 V345A probably benign Het
Mettl1 T C 10: 127,045,018 S193P probably benign Het
Mmrn1 A G 6: 60,977,383 T883A probably benign Het
Mphosph10 C G 7: 64,388,921 E293Q probably benign Het
Muc16 C A 9: 18,645,897 K3033N unknown Het
Myo16 C T 8: 10,569,496 T1349M probably damaging Het
Myo5c T C 9: 75,250,464 I233T probably benign Het
Olfr1356 C A 10: 78,847,517 V133L probably benign Het
Olfr1465 A T 19: 13,313,672 S204R probably benign Het
Olfr190 A G 16: 59,074,192 M296T probably benign Het
Olfr475-ps1 A G 2: 88,623,845 T181A unknown Het
Olfr622 T G 7: 103,639,858 N94T probably benign Het
Olfr655 A T 7: 104,596,811 F123L probably benign Het
Olfr791 T A 10: 129,526,863 V212E probably damaging Het
Oxct2b A G 4: 123,117,687 I467V probably benign Het
Parp1 A T 1: 180,587,371 N425Y possibly damaging Het
Pcdhgc3 T A 18: 37,806,603 V19D possibly damaging Het
Pfkl T A 10: 77,997,589 I260F probably damaging Het
Pkd1l1 C T 11: 8,849,046 G1789R probably damaging Het
Pla1a G A 16: 38,397,468 A386V probably benign Het
Pml A G 9: 58,234,886 L221P probably damaging Het
Rcn2 C T 9: 56,057,561 Q268* probably null Het
Reps1 T A 10: 18,093,855 D235E probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sap30bp A G 11: 115,933,488 probably benign Het
Scn1a A T 2: 66,287,731 S1433T probably damaging Het
Sde2 T C 1: 180,851,189 V6A probably benign Het
Sdk1 C A 5: 142,212,014 R2141S probably benign Het
Setd2 T C 9: 110,550,572 S1152P probably damaging Het
Slc26a2 C T 18: 61,201,854 V176I probably damaging Het
Snx7 A G 3: 117,846,632 I76T possibly damaging Het
Specc1l C A 10: 75,246,279 A520D probably benign Het
Spop A G 11: 95,471,310 T56A possibly damaging Het
Syne2 T A 12: 76,028,012 D4576E probably damaging Het
Tas2r134 A C 2: 51,627,589 M27L probably benign Het
Tecta A C 9: 42,366,786 I1142S probably benign Het
Timm44 T C 8: 4,266,611 D311G possibly damaging Het
Tmem123 C G 9: 7,791,070 T124R possibly damaging Het
Tmem184b A T 15: 79,362,759 L370Q probably benign Het
Trim25 T A 11: 88,999,503 N5K probably benign Het
Vmn2r93 A G 17: 18,304,641 Y187C probably damaging Het
Vpreb1 A G 16: 16,868,814 Y71H probably damaging Het
Vpreb2 T C 16: 17,980,577 S5P probably benign Het
Xpo7 A T 14: 70,669,448 C939S probably benign Het
Zfp78 C A 7: 6,378,765 S271R probably benign Het
Zic5 A T 14: 122,464,668 M217K probably benign Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63340044 missense possibly damaging 0.95
IGL00329:Mme APN 3 63380328 nonsense probably null
IGL01013:Mme APN 3 63327860 unclassified probably null
IGL01316:Mme APN 3 63340159 splice site probably benign
IGL01333:Mme APN 3 63346091 missense probably damaging 1.00
IGL01392:Mme APN 3 63362046 missense probably damaging 1.00
IGL01566:Mme APN 3 63361929 splice site probably benign
IGL01739:Mme APN 3 63340113 missense possibly damaging 0.78
IGL01996:Mme APN 3 63343549 missense probably benign 0.11
IGL02125:Mme APN 3 63348649 missense probably damaging 1.00
IGL02154:Mme APN 3 63343555 missense probably benign
IGL03214:Mme APN 3 63329690 missense possibly damaging 0.72
IGL03291:Mme APN 3 63346104 missense probably benign 0.00
R0498:Mme UTSW 3 63346066 missense probably damaging 1.00
R0595:Mme UTSW 3 63328181 missense probably benign 0.27
R0980:Mme UTSW 3 63340129 missense probably benign
R1210:Mme UTSW 3 63343606 missense probably benign 0.01
R1600:Mme UTSW 3 63365058 missense probably damaging 1.00
R1852:Mme UTSW 3 63327983 missense probably benign 0.31
R1852:Mme UTSW 3 63328046 missense probably benign 0.00
R2037:Mme UTSW 3 63328260 missense probably null 1.00
R2177:Mme UTSW 3 63301005 missense probably benign 0.02
R2200:Mme UTSW 3 63380292 missense possibly damaging 0.87
R2306:Mme UTSW 3 63300252 missense probably benign 0.00
R2847:Mme UTSW 3 63345199 missense possibly damaging 0.91
R3008:Mme UTSW 3 63358957 missense probably damaging 1.00
R3749:Mme UTSW 3 63343540 missense probably damaging 1.00
R3876:Mme UTSW 3 63362059 splice site probably benign
R3961:Mme UTSW 3 63345192 missense probably damaging 1.00
R3981:Mme UTSW 3 63328064 missense probably damaging 1.00
R3982:Mme UTSW 3 63328064 missense probably damaging 1.00
R3983:Mme UTSW 3 63328064 missense probably damaging 1.00
R4494:Mme UTSW 3 63347192 missense probably benign
R4589:Mme UTSW 3 63380272 missense probably benign
R4706:Mme UTSW 3 63348712 missense possibly damaging 0.92
R4871:Mme UTSW 3 63340032 missense probably benign 0.01
R4957:Mme UTSW 3 63343489 splice site probably benign
R5053:Mme UTSW 3 63364849 missense probably damaging 1.00
R5316:Mme UTSW 3 63368954 missense probably damaging 1.00
R5502:Mme UTSW 3 63300281 nonsense probably null
R5579:Mme UTSW 3 63348645 missense probably damaging 1.00
R6007:Mme UTSW 3 63343508 nonsense probably null
R6022:Mme UTSW 3 63364797 missense probably damaging 1.00
R6143:Mme UTSW 3 63300111 splice site probably null
R6154:Mme UTSW 3 63300253 missense probably damaging 0.98
R6333:Mme UTSW 3 63341961 missense probably benign 0.00
R6476:Mme UTSW 3 63343635 critical splice donor site probably null
R6514:Mme UTSW 3 63364844 nonsense probably null
R6711:Mme UTSW 3 63341918 missense possibly damaging 0.93
R6842:Mme UTSW 3 63362044 missense probably damaging 1.00
R7040:Mme UTSW 3 63368923 missense probably damaging 1.00
R7043:Mme UTSW 3 63345217 nonsense probably null
R7084:Mme UTSW 3 63328217 missense probably damaging 0.98
R7126:Mme UTSW 3 63368901 missense probably damaging 0.97
X0058:Mme UTSW 3 63365021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTTGCAGGGAGGTCAGAATTC -3'
(R):5'- AACCTCGCATTTGTCCACTG -3'

Sequencing Primer
(F):5'- TACAAGGGCAGCATGCA -3'
(R):5'- TCAGGTCATGCTTACAAGGC -3'
Posted On2019-05-13