Incidental Mutation 'R6997:Myh13'
ID544296
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
MMRRC Submission
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6997 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 67327154 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 18 (R18*)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect probably null
Transcript: ENSMUST00000081911
AA Change: R18*
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: R18*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108684
AA Change: R18*
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: R18*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180845
AA Change: R18*
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: R18*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (58/60)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,681,523 Y764C probably benign Het
Atxn1 C T 13: 45,567,619 V267M probably benign Het
Cadps T A 14: 12,505,793 H759L possibly damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Caprin2 A G 6: 148,877,976 L111P probably damaging Het
Ccl8 A T 11: 82,116,039 D26V possibly damaging Het
Cdh19 T C 1: 110,954,866 probably benign Het
Cnga3 C A 1: 37,244,884 H89Q probably benign Het
Cnga4 A T 7: 105,406,983 Q264L probably damaging Het
Coil A G 11: 88,981,847 T345A probably benign Het
Cyp11b2 A G 15: 74,851,432 L461P probably damaging Het
Dock2 T C 11: 34,464,922 E151G probably damaging Het
Dsc1 C T 18: 20,086,644 probably null Het
Dync2h1 A T 9: 7,168,743 C357S probably null Het
Ebf3 A C 7: 137,225,265 I306R probably damaging Het
Eprs A G 1: 185,396,163 H580R possibly damaging Het
Ermap A T 4: 119,178,613 F393I probably damaging Het
Flii T C 11: 60,722,325 T217A probably benign Het
Fras1 C T 5: 96,614,873 Q745* probably null Het
Gja8 A G 3: 96,919,341 V335A probably benign Het
Gm21560 A T 14: 6,218,333 N48K probably damaging Het
Gpr158 C T 2: 21,648,991 T457I possibly damaging Het
Kcnv1 A T 15: 45,114,601 S14T unknown Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Map1b T C 13: 99,430,634 T1860A unknown Het
Map2k7 T C 8: 4,244,035 Y194H possibly damaging Het
Map4 T A 9: 110,052,914 M282K probably benign Het
Mkl1 G T 15: 81,018,448 S220* probably null Het
Mmp10 A G 9: 7,503,530 I134V probably benign Het
Msh5 A T 17: 35,030,002 L685Q probably damaging Het
Myh1 T A 11: 67,220,637 I1634N possibly damaging Het
Myo3b A T 2: 70,126,985 I185L probably damaging Het
Ninl G T 2: 150,966,225 H294Q probably benign Het
Olfr1252 G A 2: 89,721,925 A62V possibly damaging Het
Olfr64 A T 7: 103,893,031 S235T probably benign Het
Olfr907 T C 9: 38,499,311 I214T possibly damaging Het
Orm3 T A 4: 63,356,943 L97Q probably damaging Het
Osbpl1a T C 18: 12,756,224 N432S probably benign Het
Pikfyve T A 1: 65,246,663 D1020E probably damaging Het
Pxk T A 14: 8,122,371 D60E probably benign Het
Rack1 T A 11: 48,803,925 V198E probably damaging Het
Ripk1 C T 13: 34,017,117 A271V probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 G T 13: 11,654,380 H3513N possibly damaging Het
Scn7a A T 2: 66,703,803 D509E probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sfxn5 A G 6: 85,256,432 V181A probably benign Het
Slc5a4b C T 10: 76,089,978 A198T probably damaging Het
Sp2 C T 11: 96,957,726 R357H possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tnfrsf11b G A 15: 54,252,374 L276F probably damaging Het
Usp37 A G 1: 74,453,959 V723A probably benign Het
Usp45 G T 4: 21,781,844 R36I probably damaging Het
Vcan T C 13: 89,690,618 D2269G probably damaging Het
Vmn2r18 T A 5: 151,561,873 M719L possibly damaging Het
Vmn2r52 C T 7: 10,169,071 G477R probably benign Het
Vmn2r60 C A 7: 42,142,292 N546K probably benign Het
Wnt8b G A 19: 44,511,841 C289Y probably damaging Het
Zdbf2 T G 1: 63,290,766 M10R probably benign Het
Zfp945 T A 17: 22,852,569 K140* probably null Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGGTTTGCTCCAAGAG -3'
(R):5'- AGAGGAAAGCTTCGATGCCTAC -3'

Sequencing Primer
(F):5'- AAGAGCTCCTGAGTCTTCACC -3'
(R):5'- AGCTTCGATGCCTACATTATTAAAG -3'
Posted On2019-05-13