Incidental Mutation 'R6998:Cdk11b'
ID544335
Institutional Source Beutler Lab
Gene Symbol Cdk11b
Ensembl Gene ENSMUSG00000029062
Gene Namecyclin-dependent kinase 11B
SynonymsPITSLRE proteins, CDK11-p110, Cdc2l1, Cdc2l2, CDK11-p46, CDK11-p58
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6998 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155624854-155649938 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 155648343 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 546 (W546*)
Ref Sequence ENSEMBL: ENSMUSP00000101225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030937] [ENSMUST00000067081] [ENSMUST00000105598] [ENSMUST00000105600] [ENSMUST00000115821]
Predicted Effect probably benign
Transcript: ENSMUST00000030937
SMART Domains Protein: ENSMUSP00000030937
Gene: ENSMUSG00000029061

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
ZnMc 85 256 8.39e-48 SMART
ShKT 255 291 4.06e-10 SMART
IG 307 390 4.53e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067081
AA Change: W546*
SMART Domains Protein: ENSMUSP00000070527
Gene: ENSMUSG00000029062
AA Change: W546*

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105598
AA Change: W512*
SMART Domains Protein: ENSMUSP00000101223
Gene: ENSMUSG00000029062
AA Change: W512*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
coiled coil region 89 180 N/A INTRINSIC
low complexity region 218 225 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
coiled coil region 256 303 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
S_TKc 393 678 5.05e-93 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105600
AA Change: W546*
SMART Domains Protein: ENSMUSP00000101225
Gene: ENSMUSG00000029062
AA Change: W546*

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. Members of this kinase family are known to be essential for eukaryotic cell cycle control. Due to a segmental duplication, this gene shares very high sequence identity with a neighboring gene. These two genes are frequently deleted or altered in neuroblastoma. The protein kinase encoded by this gene can be cleaved by caspases and may play a role in cell apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null embryos display embryonic lethality from cell cycle arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,162,710 R620G probably benign Het
Adcy1 A C 11: 7,079,026 N259H probably damaging Het
Ahctf1 G A 1: 179,770,915 R2* probably null Het
Akr1c21 A G 13: 4,583,851 I306M probably benign Het
Alg9 T A 9: 50,789,621 S230R possibly damaging Het
Armt1 T A 10: 4,453,937 C341S probably benign Het
Aspg T A 12: 112,112,194 L29M probably damaging Het
Aspm C T 1: 139,469,472 T934I probably damaging Het
C1rl T C 6: 124,508,902 S411P probably damaging Het
Card14 A G 11: 119,322,899 E224G probably damaging Het
Ccdc88c T C 12: 100,916,852 H1587R probably damaging Het
Ccp110 A G 7: 118,732,897 T963A possibly damaging Het
Cyp8b1 T C 9: 121,915,993 N91S probably benign Het
Dab2 G T 15: 6,424,649 M213I possibly damaging Het
Decr1 A G 4: 15,930,960 V124A probably damaging Het
Fbxl13 T A 5: 21,543,689 I411F probably damaging Het
Fbxl13 T C 5: 21,620,613 I164V probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Garem2 T C 5: 30,114,170 M210T possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Ighv1-52 C A 12: 115,145,492 A115S probably benign Het
Igkv6-13 A G 6: 70,457,589 S91P probably damaging Het
Ints8 T A 4: 11,204,537 E973V possibly damaging Het
Itga3 T C 11: 95,051,462 K972R probably benign Het
Klhl33 A T 14: 50,893,021 F339I probably benign Het
Krt79 T C 15: 101,937,872 M214V probably benign Het
Lgsn A T 1: 31,204,193 H452L probably benign Het
Limd2 C T 11: 106,158,690 G124D probably benign Het
Luzp1 T C 4: 136,543,444 S993P probably damaging Het
Maml2 C T 9: 13,621,185 probably benign Het
Mbtd1 A T 11: 93,924,612 H342L probably damaging Het
Mfhas1 C A 8: 35,591,356 P995Q probably damaging Het
Muc5ac T C 7: 141,818,714 F3399S possibly damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2 G T 2: 29,912,617 A298S probably benign Het
Olfr1082 A T 2: 86,594,144 M228K probably damaging Het
Olfr1193 A T 2: 88,678,508 I218F probably benign Het
Olfr740 A T 14: 50,453,433 Y127F probably benign Het
Pcsk5 T C 19: 17,473,112 D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pik3c2b T G 1: 133,102,372 I1457S probably benign Het
Pole2 T C 12: 69,213,906 T167A possibly damaging Het
Rfx7 T A 9: 72,618,505 S992R probably damaging Het
Ryr2 G T 13: 11,712,166 S2436R probably damaging Het
Sgo2a A G 1: 58,016,640 D661G probably damaging Het
Sh3glb2 T A 2: 30,355,321 T49S probably damaging Het
Slc16a10 T C 10: 40,056,503 K354R possibly damaging Het
Slc6a6 C A 6: 91,752,438 T568K probably benign Het
Sptbn1 T C 11: 30,100,633 T2319A probably damaging Het
Tbl1xr1 T A 3: 22,179,290 Y15N probably damaging Het
Thyn1 T C 9: 27,006,442 S160P probably damaging Het
Tshz1 A T 18: 84,015,841 D147E probably benign Het
Vmn2r50 T G 7: 10,037,757 R672S probably benign Het
Zfp663 A T 2: 165,354,002 I99N possibly damaging Het
Other mutations in Cdk11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01764:Cdk11b APN 4 155628803 missense possibly damaging 0.54
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0145:Cdk11b UTSW 4 155641619 intron probably benign
R0372:Cdk11b UTSW 4 155641500 intron probably benign
R0426:Cdk11b UTSW 4 155642512 intron probably benign
R0471:Cdk11b UTSW 4 155647542 unclassified probably benign
R0627:Cdk11b UTSW 4 155640772 intron probably benign
R1475:Cdk11b UTSW 4 155634217 missense probably damaging 1.00
R1611:Cdk11b UTSW 4 155641575 intron probably benign
R1719:Cdk11b UTSW 4 155648397 unclassified probably benign
R1750:Cdk11b UTSW 4 155628680 intron probably null
R2061:Cdk11b UTSW 4 155641604 intron probably benign
R2274:Cdk11b UTSW 4 155647594 unclassified probably benign
R2922:Cdk11b UTSW 4 155640744 intron probably benign
R3719:Cdk11b UTSW 4 155626886 missense probably damaging 1.00
R3917:Cdk11b UTSW 4 155626801 missense probably damaging 1.00
R4077:Cdk11b UTSW 4 155639747 intron probably benign
R4078:Cdk11b UTSW 4 155639747 intron probably benign
R5033:Cdk11b UTSW 4 155648825 unclassified probably benign
R5212:Cdk11b UTSW 4 155638615 intron probably null
R5556:Cdk11b UTSW 4 155634147 nonsense probably null
R5622:Cdk11b UTSW 4 155630217 missense probably damaging 1.00
R5927:Cdk11b UTSW 4 155648240 unclassified probably benign
R5975:Cdk11b UTSW 4 155648240 unclassified probably benign
R6276:Cdk11b UTSW 4 155634190 missense probably benign 0.11
R6278:Cdk11b UTSW 4 155649603 unclassified probably benign
R6905:Cdk11b UTSW 4 155641608 intron probably benign
R7021:Cdk11b UTSW 4 155641567 intron probably benign
R7062:Cdk11b UTSW 4 155626811 missense probably damaging 1.00
R7100:Cdk11b UTSW 4 155625593 missense probably damaging 1.00
Z1088:Cdk11b UTSW 4 155641564 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTGCCCCAGAAGTCTAGTTGC -3'
(R):5'- CACAGGGTTACAACAACTGGAG -3'

Sequencing Primer
(F):5'- CCCAGAAGTCTAGTTGCTGCTG -3'
(R):5'- GCCTTTAGGGGTGAACCATACTC -3'
Posted On2019-05-13