Incidental Mutation 'R0608:Cfap70'
ID54434
Institutional Source Beutler Lab
Gene Symbol Cfap70
Ensembl Gene ENSMUSG00000039543
Gene Namecilia and flagella associated protein 70
Synonyms5330402L21Rik, Ttc18
MMRRC Submission 038797-MU
Accession Numbers

NCBI RefSeq: NM_001163638.1, NM_001163639.1, NM_029698.1; MGI: 1923920

Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0608 (G1)
Quality Score103
Status Not validated
Chromosome14
Chromosomal Location20394193-20452226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20448563 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 19 (Y19N)
Ref Sequence ENSEMBL: ENSMUSP00000022349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022348] [ENSMUST00000022349] [ENSMUST00000056073]
Predicted Effect probably benign
Transcript: ENSMUST00000022348
AA Change: Y19N

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022348
Gene: ENSMUSG00000039543
AA Change: Y19N

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 581 590 N/A INTRINSIC
Blast:TPR 591 623 2e-11 BLAST
Blast:TPR 624 657 3e-15 BLAST
TPR 658 691 1.73e1 SMART
Blast:TPR 693 724 2e-7 BLAST
TPR 905 938 1.26e1 SMART
TPR 939 972 5.03e-1 SMART
TPR 976 1009 2.52e-1 SMART
TPR 1043 1076 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022349
AA Change: Y19N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022349
Gene: ENSMUSG00000039543
AA Change: Y19N

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 438 447 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
Blast:TPR 579 611 2e-11 BLAST
Blast:TPR 612 645 3e-15 BLAST
TPR 646 679 1.73e1 SMART
Blast:TPR 681 712 2e-7 BLAST
TPR 932 965 1.26e1 SMART
TPR 966 999 5.03e-1 SMART
TPR 1003 1036 2.52e-1 SMART
TPR 1070 1103 2.07e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056073
AA Change: Y19N

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056869
Gene: ENSMUSG00000039543
AA Change: Y19N

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 625 634 N/A INTRINSIC
Blast:TPR 635 667 2e-11 BLAST
Blast:TPR 668 701 3e-15 BLAST
TPR 702 735 1.73e1 SMART
Blast:TPR 737 768 2e-7 BLAST
TPR 949 982 1.26e1 SMART
TPR 983 1016 5.03e-1 SMART
TPR 1020 1053 2.52e-1 SMART
TPR 1087 1120 2.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143940
Predicted Effect probably benign
Transcript: ENSMUST00000144797
AA Change: Y19N

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116668
Gene: ENSMUSG00000039543
AA Change: Y19N

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
Blast:TPR 640 672 2e-11 BLAST
Blast:TPR 673 706 3e-15 BLAST
TPR 707 740 1.73e1 SMART
Blast:TPR 742 773 2e-7 BLAST
TPR 954 987 1.26e1 SMART
TPR 988 1021 5.03e-1 SMART
TPR 1025 1058 2.52e-1 SMART
TPR 1092 1125 2.07e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151077
AA Change: Y19N

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119023
Gene: ENSMUSG00000039543
AA Change: Y19N

DomainStartEndE-ValueType
Blast:C2 11 122 8e-48 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI

All alleles(17) : Targeted(2) Gene trapped(15)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ampd3 C A 7: 110,795,790 D315E probably damaging Het
Ampd3 T A 7: 110,795,791 F316I probably damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atxn2l A G 7: 126,501,416 probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Bckdhb T G 9: 83,953,736 F98V probably damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Ccdc28a G A 10: 18,224,951 R90C probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cep128 T G 12: 90,999,535 probably benign Het
Cep72 A T 13: 74,038,304 H249Q probably damaging Het
Col11a1 T C 3: 114,218,715 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah17 G T 11: 118,090,749 Y1716* probably null Het
Dnm1 T C 2: 32,335,824 E383G possibly damaging Het
Dst C A 1: 34,290,356 probably null Het
Edil3 T C 13: 89,184,849 S375P probably damaging Het
Eme1 A G 11: 94,650,082 C277R probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Fbxl6 C T 15: 76,536,753 V341M probably benign Het
Fgf14 A G 14: 124,676,603 S39P probably damaging Het
Fmo4 C T 1: 162,803,651 R249H possibly damaging Het
Gle1 T A 2: 29,940,228 D265E probably benign Het
Gml2 T C 15: 74,821,386 probably null Het
Golgb1 G T 16: 36,916,330 E1980* probably null Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Heca T C 10: 17,915,291 D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 T101A possibly damaging Het
Ift88 T C 14: 57,496,221 V707A probably benign Het
Kdm3a C T 6: 71,620,046 G252D probably benign Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Kntc1 A T 5: 123,786,074 N1008Y probably damaging Het
Lrp2 G T 2: 69,486,243 N2131K probably benign Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magi3 C G 3: 104,017,557 G1092A probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrps26 G T 2: 130,563,858 R27L possibly damaging Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Naif1 T C 2: 32,454,896 M204T probably benign Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Neb A T 2: 52,326,757 D135E probably benign Het
Nlrp6 C T 7: 140,923,486 Q502* probably null Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Pnpla8 C T 12: 44,283,463 P48L probably benign Het
Rab44 T A 17: 29,147,343 probably null Het
Ranbp2 T C 10: 58,493,898 I3031T probably damaging Het
Rnf219 T C 14: 104,479,527 Y470C probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Serpinh1 A G 7: 99,349,394 C10R unknown Het
Sh2d4a A G 8: 68,346,694 Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spire1 T C 18: 67,528,875 R163G probably damaging Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Susd2 C T 10: 75,638,235 A509T probably benign Het
Sycp2 A G 2: 178,382,404 F396L probably damaging Het
Syne2 T C 12: 75,963,813 L2499P probably damaging Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tab2 C T 10: 7,920,119 V126I probably damaging Het
Tecpr1 T C 5: 144,211,499 T363A probably damaging Het
Terb2 A G 2: 122,186,335 D16G probably benign Het
Tm2d2 A G 8: 25,020,536 E137G probably benign Het
Trim30d T A 7: 104,472,485 H201L probably damaging Het
Tspan3 A G 9: 56,147,385 probably null Het
Ttn A T 2: 76,787,323 L16268Q probably damaging Het
Ttn A T 2: 76,796,185 probably null Het
Ubap2 T A 4: 41,218,319 T263S probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zeb2 A T 2: 44,996,126 M973K possibly damaging Het
Zfp229 A G 17: 21,746,634 E615G probably damaging Het
Zfp655 T A 5: 145,244,057 S242T possibly damaging Het
Zfp788 T A 7: 41,648,281 F62I possibly damaging Het
Zmynd8 A G 2: 165,787,158 probably null Het
Other mutations in Cfap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Cfap70 APN 14 20412462 missense possibly damaging 0.77
IGL00567:Cfap70 APN 14 20394680 missense probably benign 0.30
IGL00773:Cfap70 APN 14 20447534 missense probably damaging 1.00
IGL01061:Cfap70 APN 14 20447625 splice site probably benign
IGL01520:Cfap70 APN 14 20420687 missense probably benign 0.23
IGL01665:Cfap70 APN 14 20403118 missense probably damaging 1.00
IGL01918:Cfap70 APN 14 20425399 missense possibly damaging 0.81
IGL02211:Cfap70 APN 14 20394972 missense probably damaging 1.00
IGL02613:Cfap70 APN 14 20409064 unclassified probably null
IGL03142:Cfap70 APN 14 20397215 missense probably damaging 0.99
IGL03354:Cfap70 APN 14 20431982 missense probably damaging 1.00
IGL03047:Cfap70 UTSW 14 20448578 missense possibly damaging 0.92
IGL03097:Cfap70 UTSW 14 20448608 missense probably benign 0.00
P0008:Cfap70 UTSW 14 20416532 missense probably damaging 0.99
P0035:Cfap70 UTSW 14 20424471 splice site probably benign
R0200:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0207:Cfap70 UTSW 14 20412347 missense probably damaging 1.00
R0238:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0238:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0239:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0239:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0463:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0703:Cfap70 UTSW 14 20439715 missense probably damaging 1.00
R0919:Cfap70 UTSW 14 20404164 missense probably benign 0.00
R0928:Cfap70 UTSW 14 20443919 missense probably damaging 1.00
R1595:Cfap70 UTSW 14 20447536 missense probably benign 0.10
R1667:Cfap70 UTSW 14 20404157 missense probably benign 0.41
R1799:Cfap70 UTSW 14 20394999 missense probably damaging 1.00
R1869:Cfap70 UTSW 14 20408610 nonsense probably null
R1920:Cfap70 UTSW 14 20394952 missense probably damaging 1.00
R1968:Cfap70 UTSW 14 20420811 missense possibly damaging 0.93
R2173:Cfap70 UTSW 14 20408562 missense probably benign 0.00
R3081:Cfap70 UTSW 14 20420762 missense probably damaging 1.00
R3813:Cfap70 UTSW 14 20421122 missense possibly damaging 0.95
R3979:Cfap70 UTSW 14 20439719 missense probably benign 0.11
R4093:Cfap70 UTSW 14 20409113 missense probably damaging 1.00
R4271:Cfap70 UTSW 14 20420725 missense probably benign 0.00
R4604:Cfap70 UTSW 14 20443661 missense probably benign 0.01
R4839:Cfap70 UTSW 14 20425529 missense probably damaging 0.96
R6387:Cfap70 UTSW 14 20448575 missense probably damaging 1.00
R6464:Cfap70 UTSW 14 20401039 intron probably null
R6915:Cfap70 UTSW 14 20409085 missense probably benign 0.17
R7317:Cfap70 UTSW 14 20400434 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGACTCGCAGAGTACAGACTACCAC -3'
(R):5'- TGGGACATAATCTTGGAAGGGAGCC -3'

Sequencing Primer
(F):5'- CCACGGAACACCTTGAGAAG -3'
(R):5'- ACCACTTATGTGTTGAGGGAC -3'
Posted On2013-07-11