Incidental Mutation 'R6999:Brinp2'
ID544376
Institutional Source Beutler Lab
Gene Symbol Brinp2
Ensembl Gene ENSMUSG00000004031
Gene Namebone morphogenic protein/retinoic acid inducible neural-specific 2
Synonyms6430517E21Rik, Fam5b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R6999 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location158245269-158356326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 158251305 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 316 (M316T)
Ref Sequence ENSEMBL: ENSMUSP00000004133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004133] [ENSMUST00000195271]
Predicted Effect probably benign
Transcript: ENSMUST00000004133
AA Change: M316T

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000004133
Gene: ENSMUSG00000004031
AA Change: M316T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
MACPF 89 281 6.58e-50 SMART
Blast:MACPF 338 362 1e-5 BLAST
EGF 457 492 6.92e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195271
SMART Domains Protein: ENSMUSP00000141709
Gene: ENSMUSG00000004031

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:MACPF 63 160 2.1e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,317,162 Q629* probably null Het
Acss3 C A 10: 107,053,501 G153C probably damaging Het
Alpk2 A G 18: 65,304,513 S1270P probably damaging Het
Ankrd10 A T 8: 11,619,106 L215Q probably damaging Het
Ankrd6 A G 4: 32,823,459 S188P probably benign Het
Bsn A G 9: 108,113,433 S1707P probably benign Het
C2cd4b C T 9: 67,760,289 A189V probably benign Het
Camk2b C T 11: 5,972,321 R556H probably damaging Het
Cfap126 A G 1: 171,126,164 D101G possibly damaging Het
Chd5 A T 4: 152,374,434 I1085F probably damaging Het
Chp2 A G 7: 122,221,869 E151G probably damaging Het
Chrd A G 16: 20,735,652 T370A probably benign Het
Chrnb2 C T 3: 89,761,315 R231H possibly damaging Het
Crisp4 T A 1: 18,137,035 I10F possibly damaging Het
Csnka2ip T A 16: 64,478,570 H477L unknown Het
Ctu1 T A 7: 43,675,238 F34I probably damaging Het
Dctn1 T A 6: 83,191,281 S407T possibly damaging Het
E330021D16Rik T C 6: 136,401,274 N186S probably benign Het
Ech1 T C 7: 28,830,264 F191L probably benign Het
Enpp3 T C 10: 24,808,166 D60G probably damaging Het
Epha6 T C 16: 60,425,170 Y222C possibly damaging Het
Eppk1 A T 15: 76,109,223 W1153R probably benign Het
Fbxo4 C T 15: 3,977,955 D76N probably damaging Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Gemin5 C T 11: 58,125,121 R1352Q probably benign Het
Gm4969 A G 7: 19,102,375 probably benign Het
Gm9639 T C 10: 77,794,691 probably benign Het
Gm973 C A 1: 59,634,092 Q160K unknown Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid2 A T 6: 64,076,909 Q364L possibly damaging Het
Kcnn2 T G 18: 45,592,377 S313R probably damaging Het
Kera T C 10: 97,608,952 Y58H probably damaging Het
Mtfr2 T C 10: 20,354,116 L105P probably benign Het
Myom2 A G 8: 15,084,531 T445A probably benign Het
Olfr1394 A G 11: 49,160,412 R133G possibly damaging Het
Olfr905 T A 9: 38,473,239 L164Q probably damaging Het
Pcdha12 T C 18: 37,020,276 L16P probably benign Het
Pcdhb10 T C 18: 37,413,118 Y416H probably damaging Het
Pde8b T C 13: 95,086,834 Y304C possibly damaging Het
Pkd1 T C 17: 24,578,501 I2605T possibly damaging Het
Pnn T C 12: 59,070,299 probably null Het
Ppa1 G A 10: 61,661,017 G95S probably damaging Het
Rapgef4 G T 2: 72,239,125 A730S probably damaging Het
Scap A G 9: 110,384,647 Y1226C probably damaging Het
Scn2a A T 2: 65,682,109 T197S probably benign Het
Slc2a6 GCTTCC GC 2: 27,026,035 probably null Het
Slc8a3 T C 12: 81,314,755 Y430C probably benign Het
Tead3 T C 17: 28,341,532 T33A probably benign Het
Tep1 T A 14: 50,850,705 I792F possibly damaging Het
Trpm2 A T 10: 77,935,891 I638N probably damaging Het
Tuba1c A G 15: 99,037,312 D218G probably benign Het
Tubgcp4 T A 2: 121,192,297 W495R probably damaging Het
Tut1 T C 19: 8,966,018 L823P probably damaging Het
Umodl1 C T 17: 30,999,123 A1228V probably damaging Het
Vmn1r235 T A 17: 21,261,865 F151I probably benign Het
Vmn2r45 T A 7: 8,483,220 K356N probably benign Het
Zfp318 T A 17: 46,400,043 N897K probably damaging Het
Other mutations in Brinp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Brinp2 APN 1 158247100 missense probably benign 0.04
IGL01537:Brinp2 APN 1 158246809 missense probably damaging 1.00
IGL02354:Brinp2 APN 1 158247178 missense probably damaging 1.00
IGL02361:Brinp2 APN 1 158247178 missense probably damaging 1.00
R0334:Brinp2 UTSW 1 158295585 missense probably benign 0.06
R0652:Brinp2 UTSW 1 158246621 missense probably damaging 1.00
R1017:Brinp2 UTSW 1 158249451 missense probably damaging 0.99
R1141:Brinp2 UTSW 1 158247270 missense probably damaging 0.99
R1378:Brinp2 UTSW 1 158247054 missense possibly damaging 0.82
R1666:Brinp2 UTSW 1 158246558 missense probably damaging 1.00
R1892:Brinp2 UTSW 1 158254972 critical splice donor site probably null
R1986:Brinp2 UTSW 1 158246778 missense probably damaging 1.00
R3876:Brinp2 UTSW 1 158246846 missense probably damaging 0.99
R3924:Brinp2 UTSW 1 158246208 missense probably damaging 1.00
R4582:Brinp2 UTSW 1 158267938 missense probably damaging 1.00
R5239:Brinp2 UTSW 1 158251338 missense probably benign 0.00
R5537:Brinp2 UTSW 1 158255013 missense probably damaging 0.97
R5582:Brinp2 UTSW 1 158249409 missense probably damaging 1.00
R5762:Brinp2 UTSW 1 158246586 missense probably benign
R5922:Brinp2 UTSW 1 158249355 missense possibly damaging 0.79
R6746:Brinp2 UTSW 1 158266590 missense probably benign
R7144:Brinp2 UTSW 1 158295424 critical splice donor site probably null
R7221:Brinp2 UTSW 1 158266547 missense possibly damaging 0.90
R7376:Brinp2 UTSW 1 158251368 missense probably damaging 0.98
R7381:Brinp2 UTSW 1 158246343 missense probably benign 0.11
R7388:Brinp2 UTSW 1 158255009 missense probably damaging 1.00
R7531:Brinp2 UTSW 1 158266572 missense possibly damaging 0.95
X0024:Brinp2 UTSW 1 158267983 nonsense probably null
Z1088:Brinp2 UTSW 1 158246989 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTTAAGACCCTTGGTGACC -3'
(R):5'- ACACTGGTTCTGCTCACTGAC -3'

Sequencing Primer
(F):5'- AGACCCTTGGTGACCATAATAATC -3'
(R):5'- TCTTCCCCAGGCCTGCAG -3'
Posted On2019-05-13