Incidental Mutation 'R0608:Parp4'
ID54438
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Namepoly (ADP-ribose) polymerase family, member 4
Synonymsp193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik
MMRRC Submission 038797-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R0608 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location56575619-56659794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56602404 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 523 (V523E)
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160334
Predicted Effect probably damaging
Transcript: ENSMUST00000161553
AA Change: V523E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: V523E

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ampd3 C A 7: 110,795,790 D315E probably damaging Het
Ampd3 T A 7: 110,795,791 F316I probably damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atxn2l A G 7: 126,501,416 probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Bckdhb T G 9: 83,953,736 F98V probably damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Ccdc28a G A 10: 18,224,951 R90C probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cep128 T G 12: 90,999,535 probably benign Het
Cep72 A T 13: 74,038,304 H249Q probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Col11a1 T C 3: 114,218,715 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah17 G T 11: 118,090,749 Y1716* probably null Het
Dnm1 T C 2: 32,335,824 E383G possibly damaging Het
Dst C A 1: 34,290,356 probably null Het
Edil3 T C 13: 89,184,849 S375P probably damaging Het
Eme1 A G 11: 94,650,082 C277R probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Fbxl6 C T 15: 76,536,753 V341M probably benign Het
Fgf14 A G 14: 124,676,603 S39P probably damaging Het
Fmo4 C T 1: 162,803,651 R249H possibly damaging Het
Gle1 T A 2: 29,940,228 D265E probably benign Het
Gml2 T C 15: 74,821,386 probably null Het
Golgb1 G T 16: 36,916,330 E1980* probably null Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Heca T C 10: 17,915,291 D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 T101A possibly damaging Het
Ift88 T C 14: 57,496,221 V707A probably benign Het
Kdm3a C T 6: 71,620,046 G252D probably benign Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Kntc1 A T 5: 123,786,074 N1008Y probably damaging Het
Lrp2 G T 2: 69,486,243 N2131K probably benign Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magi3 C G 3: 104,017,557 G1092A probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrps26 G T 2: 130,563,858 R27L possibly damaging Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Naif1 T C 2: 32,454,896 M204T probably benign Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Neb A T 2: 52,326,757 D135E probably benign Het
Nlrp6 C T 7: 140,923,486 Q502* probably null Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Pnpla8 C T 12: 44,283,463 P48L probably benign Het
Rab44 T A 17: 29,147,343 probably null Het
Ranbp2 T C 10: 58,493,898 I3031T probably damaging Het
Rnf219 T C 14: 104,479,527 Y470C probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Serpinh1 A G 7: 99,349,394 C10R unknown Het
Sh2d4a A G 8: 68,346,694 Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spire1 T C 18: 67,528,875 R163G probably damaging Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Susd2 C T 10: 75,638,235 A509T probably benign Het
Sycp2 A G 2: 178,382,404 F396L probably damaging Het
Syne2 T C 12: 75,963,813 L2499P probably damaging Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tab2 C T 10: 7,920,119 V126I probably damaging Het
Tecpr1 T C 5: 144,211,499 T363A probably damaging Het
Terb2 A G 2: 122,186,335 D16G probably benign Het
Tm2d2 A G 8: 25,020,536 E137G probably benign Het
Trim30d T A 7: 104,472,485 H201L probably damaging Het
Tspan3 A G 9: 56,147,385 probably null Het
Ttn A T 2: 76,787,323 L16268Q probably damaging Het
Ttn A T 2: 76,796,185 probably null Het
Ubap2 T A 4: 41,218,319 T263S probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zeb2 A T 2: 44,996,126 M973K possibly damaging Het
Zfp229 A G 17: 21,746,634 E615G probably damaging Het
Zfp655 T A 5: 145,244,057 S242T possibly damaging Het
Zfp788 T A 7: 41,648,281 F62I possibly damaging Het
Zmynd8 A G 2: 165,787,158 probably null Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56616460 missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56647353 missense unknown
IGL00737:Parp4 APN 14 56584163 missense probably damaging 0.99
IGL00793:Parp4 APN 14 56602877 missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56607440 missense probably benign 0.01
IGL01131:Parp4 APN 14 56585760 splice site probably benign
IGL01485:Parp4 APN 14 56622204 missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56602326 missense probably damaging 0.99
IGL01993:Parp4 APN 14 56610788 missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56590502 missense probably benign 0.33
IGL02851:Parp4 APN 14 56648869 missense unknown
IGL02863:Parp4 APN 14 56648786 missense unknown
IGL03065:Parp4 APN 14 56637869 missense probably benign 0.09
IGL03117:Parp4 APN 14 56602856 missense probably benign 0.17
IGL03271:Parp4 APN 14 56585625 missense probably benign 0.10
IGL03309:Parp4 APN 14 56587808 missense probably benign 0.11
IGL03408:Parp4 APN 14 56602408 missense probably damaging 0.99
R0278:Parp4 UTSW 14 56607523 missense probably damaging 0.99
R0320:Parp4 UTSW 14 56588496 critical splice donor site probably null
R0445:Parp4 UTSW 14 56602748 splice site probably null
R0452:Parp4 UTSW 14 56648843 missense unknown
R0511:Parp4 UTSW 14 56635715 splice site probably benign
R0515:Parp4 UTSW 14 56613667 missense probably damaging 1.00
R0800:Parp4 UTSW 14 56589951 missense probably benign 0.00
R0959:Parp4 UTSW 14 56648119 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1342:Parp4 UTSW 14 56590397 missense probably damaging 1.00
R1520:Parp4 UTSW 14 56598406 missense probably damaging 1.00
R1565:Parp4 UTSW 14 56589872 splice site probably benign
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1649:Parp4 UTSW 14 56590428 missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56624163 missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56627381 splice site probably null
R1799:Parp4 UTSW 14 56648132 missense unknown
R1823:Parp4 UTSW 14 56589872 splice site probably benign
R1859:Parp4 UTSW 14 56648915 missense unknown
R1919:Parp4 UTSW 14 56624017 missense probably damaging 1.00
R2000:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R2032:Parp4 UTSW 14 56629096 missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56634263 missense probably damaging 1.00
R2177:Parp4 UTSW 14 56659289 missense unknown
R2291:Parp4 UTSW 14 56613817 missense probably damaging 1.00
R2865:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R3012:Parp4 UTSW 14 56595416 critical splice donor site probably null
R3841:Parp4 UTSW 14 56587778 missense probably damaging 0.97
R3913:Parp4 UTSW 14 56620518 missense probably damaging 1.00
R4064:Parp4 UTSW 14 56624140 missense probably benign 0.06
R4201:Parp4 UTSW 14 56592391 missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56607494 missense probably damaging 1.00
R4360:Parp4 UTSW 14 56629204 missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56652304 missense unknown
R4577:Parp4 UTSW 14 56590410 missense probably benign 0.33
R4633:Parp4 UTSW 14 56647591 missense unknown
R4762:Parp4 UTSW 14 56610810 missense probably damaging 1.00
R4836:Parp4 UTSW 14 56585738 missense probably benign 0.00
R4974:Parp4 UTSW 14 56589898 missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56635731 missense possibly damaging 0.81
R5479:Parp4 UTSW 14 56624095 missense probably benign 0.01
R5683:Parp4 UTSW 14 56647429 nonsense probably null
R5884:Parp4 UTSW 14 56614750 missense probably damaging 1.00
R5965:Parp4 UTSW 14 56624032 missense probably benign 0.11
R6001:Parp4 UTSW 14 56641283 missense probably benign 0.01
R6027:Parp4 UTSW 14 56629158 missense probably benign 0.28
R6230:Parp4 UTSW 14 56607533 missense probably damaging 1.00
R6242:Parp4 UTSW 14 56595399 nonsense probably null
R6355:Parp4 UTSW 14 56602300 missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56627381 splice site probably null
R6418:Parp4 UTSW 14 56620651 critical splice donor site probably null
R6477:Parp4 UTSW 14 56647237 missense probably benign 0.00
R6542:Parp4 UTSW 14 56647882 missense unknown
R6759:Parp4 UTSW 14 56620490 missense probably benign 0.10
R6995:Parp4 UTSW 14 56613739 missense probably damaging 0.97
R7002:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R7026:Parp4 UTSW 14 56620592 missense probably benign 0.01
R7062:Parp4 UTSW 14 56614759 missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56589973 missense probably benign 0.02
R7124:Parp4 UTSW 14 56602799 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGTGCTGTCACACCGATTAATGCTC -3'
(R):5'- TGAAATGGACGCAAGCCTCTGAG -3'

Sequencing Primer
(F):5'- TTAGAGATGCCCAAGCTGTC -3'
(R):5'- TGGCCTTTGCACACTTGG -3'
Posted On2013-07-11