Incidental Mutation 'R7001:Tm6sf2'
ID544545
Institutional Source Beutler Lab
Gene Symbol Tm6sf2
Ensembl Gene ENSMUSG00000036151
Gene Nametransmembrane 6 superfamily member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7001 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70072924-70080066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 70078332 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 245 (D245A)
Ref Sequence ENSEMBL: ENSMUSP00000105788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049197] [ENSMUST00000110160]
Predicted Effect probably damaging
Transcript: ENSMUST00000049197
AA Change: D243A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046114
Gene: ENSMUSG00000036151
AA Change: D243A

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 64 84 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 171 190 N/A INTRINSIC
Pfam:DUF2781 216 357 4e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110160
AA Change: D245A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105788
Gene: ENSMUSG00000036151
AA Change: D245A

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 64 84 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 171 190 N/A INTRINSIC
Pfam:DUF2781 218 357 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show hepatosteatosis, hypocholesterolemia, increased serum alanine transaminase level, reduced VLDL-TG secretion, small VLDL particles, and lipid accumulation in enterocytes. Homozygotes for another null allele show reduced total cholesterol and LDL cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,065,511 Q154K probably benign Het
Aldh6a1 T G 12: 84,441,888 T75P probably damaging Het
Ank2 T A 3: 127,077,581 H98L probably damaging Het
Ankib1 A G 5: 3,694,781 F800S probably benign Het
Arhgap10 A T 8: 77,365,088 M434K possibly damaging Het
Cap1 A T 4: 122,864,615 F257L probably benign Het
Cdt1 T A 8: 122,572,510 H510Q probably damaging Het
Clca3b A C 3: 144,827,972 D547E possibly damaging Het
Col24a1 T C 3: 145,298,866 V35A probably benign Het
Cyp2j13 A T 4: 96,056,875 N305K probably damaging Het
D3Ertd751e T A 3: 41,758,409 probably null Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Ddc T C 11: 11,824,870 probably null Het
Dnah12 A T 14: 26,879,724 Y3713F probably damaging Het
Dock8 T A 19: 25,099,677 S504T probably benign Het
Farp2 T C 1: 93,620,184 F941L possibly damaging Het
Farp2 A G 1: 93,620,230 N956S possibly damaging Het
Fbxo3 T A 2: 104,051,224 H300Q probably damaging Het
Fcgrt T C 7: 45,102,042 T131A probably benign Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Frem1 T C 4: 82,986,561 E890G probably benign Het
Fsip2 C A 2: 82,986,925 P4334H probably damaging Het
Gcdh C A 8: 84,890,911 V227L probably benign Het
Gm8267 A C 14: 44,722,928 M120R possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Lasp1 T G 11: 97,806,833 H26Q probably damaging Het
Lrrcc1 T A 3: 14,540,095 I297N probably damaging Het
Map1b A T 13: 99,430,593 N1873K unknown Het
Map2 A G 1: 66,415,487 I1179V probably benign Het
Mtss1 A C 15: 58,948,334 probably benign Het
Mtus2 A G 5: 148,277,628 E28G probably damaging Het
Muc6 G A 7: 141,637,407 T2386I probably damaging Het
Myo3a G T 2: 22,332,377 V362L probably benign Het
N6amt1 G A 16: 87,354,292 V14M probably benign Het
Nav1 A T 1: 135,454,611 probably null Het
Nol6 A G 4: 41,121,279 S326P probably benign Het
Olfr1084 A T 2: 86,639,151 S186T probably benign Het
Olfr599 A G 7: 103,338,221 S56G possibly damaging Het
Olr1 T A 6: 129,488,111 E100V probably damaging Het
Otop3 T C 11: 115,339,653 Y119H probably damaging Het
Prpmp5 C T 6: 132,312,564 G99E unknown Het
Ryr2 A T 13: 11,794,605 M778K probably damaging Het
Serpina3n G T 12: 104,408,925 M85I probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sf3b1 A G 1: 55,001,046 V591A probably damaging Het
Sf3b1 A G 1: 55,014,481 probably null Het
Slc26a5 C T 5: 21,811,336 V646I probably damaging Het
Slitrk3 T A 3: 73,050,609 K277* probably null Het
Sv2c A G 13: 95,981,953 S463P probably benign Het
Tbc1d4 G A 14: 101,458,749 T858M probably benign Het
Tbx18 T A 9: 87,727,404 I193F probably damaging Het
Unc119 T C 11: 78,348,554 Y234H probably damaging Het
Wrn A T 8: 33,352,129 S46T probably benign Het
Zfp729a A T 13: 67,620,349 I587K probably benign Het
Zfp872 C A 9: 22,200,616 H464N probably damaging Het
Other mutations in Tm6sf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Tm6sf2 APN 8 70077915 missense probably damaging 1.00
IGL01382:Tm6sf2 APN 8 70078368 missense probably damaging 1.00
IGL01625:Tm6sf2 APN 8 70076083 missense probably null 1.00
decadence UTSW 8 70075524 missense probably damaging 1.00
R0145:Tm6sf2 UTSW 8 70077868 splice site probably benign
R0333:Tm6sf2 UTSW 8 70077914 missense probably damaging 1.00
R0502:Tm6sf2 UTSW 8 70077941 missense probably damaging 0.98
R1427:Tm6sf2 UTSW 8 70075582 missense probably damaging 0.96
R1665:Tm6sf2 UTSW 8 70078930 splice site probably benign
R1863:Tm6sf2 UTSW 8 70079725 missense probably damaging 0.99
R2106:Tm6sf2 UTSW 8 70079746 missense probably benign 0.36
R4974:Tm6sf2 UTSW 8 70075478 intron probably benign
R5358:Tm6sf2 UTSW 8 70074289 missense possibly damaging 0.90
R5875:Tm6sf2 UTSW 8 70075389 missense possibly damaging 0.58
R5914:Tm6sf2 UTSW 8 70075563 missense probably damaging 0.99
R6214:Tm6sf2 UTSW 8 70073074 missense possibly damaging 0.69
R6215:Tm6sf2 UTSW 8 70073074 missense possibly damaging 0.69
R6567:Tm6sf2 UTSW 8 70075524 missense probably damaging 1.00
R7180:Tm6sf2 UTSW 8 70076006 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTCTGCAATCTTATGGTGAACCC -3'
(R):5'- TGAAACCCTGGAGTGCTTCTG -3'

Sequencing Primer
(F):5'- TCTTATGGTGAACCCCAAGGC -3'
(R):5'- GTGTCTTAAAGCACTGGATCTCAC -3'
Posted On2019-05-13