Incidental Mutation 'R0608:Cysltr1'
ID54462
Institutional Source Beutler Lab
Gene Symbol Cysltr1
Ensembl Gene ENSMUSG00000052821
Gene Namecysteinyl leukotriene receptor 1
Synonymscysteinyl leukotriene 1 receptor, leukotriene D4 receptor, CysLT1R
MMRRC Submission 038797-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0608 (G1)
Quality Score225
Status Not validated
ChromosomeX
Chromosomal Location106574346-106603679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106578655 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 75 (V75A)
Ref Sequence ENSEMBL: ENSMUSP00000109108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064892] [ENSMUST00000101296] [ENSMUST00000101297] [ENSMUST00000113480]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064892
AA Change: V75A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063520
Gene: ENSMUSG00000052821
AA Change: V75A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 40 324 4.2e-13 PFAM
Pfam:7TM_GPCR_Srx 46 249 1.7e-8 PFAM
Pfam:7tm_1 55 310 2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101296
SMART Domains Protein: ENSMUSP00000098854
Gene: ENSMUSG00000073010

DomainStartEndE-ValueType
Pfam:7tm_1 32 209 1.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101297
SMART Domains Protein: ENSMUSP00000098855
Gene: ENSMUSG00000073010

DomainStartEndE-ValueType
Pfam:7tm_1 32 209 1.7e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113480
AA Change: V75A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109108
Gene: ENSMUSG00000052821
AA Change: V75A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 42 324 6.1e-13 PFAM
Pfam:7TM_GPCR_Srx 46 252 3.1e-8 PFAM
Pfam:7tm_1 55 310 5.7e-43 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 1 family. The encoded protein is a receptor for cysteinyl leukotrienes, and is involved in mediating bronchoconstriction via activation of a phosphatidylinositol-calcium second messenger system. Activation of the encoded receptor results in contraction and proliferation of bronchial smooth muscle cells, eosinophil migration, and damage to the mucus layer in the lung. Upregulation of this gene is associated with asthma and dysregulation may also be implicated in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gen develop normally and both sexes are fertile. However, they display abnormalities in vascular permeability associated with inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ampd3 C A 7: 110,795,790 D315E probably damaging Het
Ampd3 T A 7: 110,795,791 F316I probably damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atxn2l A G 7: 126,501,416 probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Bckdhb T G 9: 83,953,736 F98V probably damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Ccdc28a G A 10: 18,224,951 R90C probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cep128 T G 12: 90,999,535 probably benign Het
Cep72 A T 13: 74,038,304 H249Q probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Col11a1 T C 3: 114,218,715 probably benign Het
Dnah17 G T 11: 118,090,749 Y1716* probably null Het
Dnm1 T C 2: 32,335,824 E383G possibly damaging Het
Dst C A 1: 34,290,356 probably null Het
Edil3 T C 13: 89,184,849 S375P probably damaging Het
Eme1 A G 11: 94,650,082 C277R probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Fbxl6 C T 15: 76,536,753 V341M probably benign Het
Fgf14 A G 14: 124,676,603 S39P probably damaging Het
Fmo4 C T 1: 162,803,651 R249H possibly damaging Het
Gle1 T A 2: 29,940,228 D265E probably benign Het
Gml2 T C 15: 74,821,386 probably null Het
Golgb1 G T 16: 36,916,330 E1980* probably null Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Heca T C 10: 17,915,291 D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 T101A possibly damaging Het
Ift88 T C 14: 57,496,221 V707A probably benign Het
Kdm3a C T 6: 71,620,046 G252D probably benign Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Kntc1 A T 5: 123,786,074 N1008Y probably damaging Het
Lrp2 G T 2: 69,486,243 N2131K probably benign Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magi3 C G 3: 104,017,557 G1092A probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrps26 G T 2: 130,563,858 R27L possibly damaging Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Naif1 T C 2: 32,454,896 M204T probably benign Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Neb A T 2: 52,326,757 D135E probably benign Het
Nlrp6 C T 7: 140,923,486 Q502* probably null Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Pnpla8 C T 12: 44,283,463 P48L probably benign Het
Rab44 T A 17: 29,147,343 probably null Het
Ranbp2 T C 10: 58,493,898 I3031T probably damaging Het
Rnf219 T C 14: 104,479,527 Y470C probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Serpinh1 A G 7: 99,349,394 C10R unknown Het
Sh2d4a A G 8: 68,346,694 Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spire1 T C 18: 67,528,875 R163G probably damaging Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Susd2 C T 10: 75,638,235 A509T probably benign Het
Sycp2 A G 2: 178,382,404 F396L probably damaging Het
Syne2 T C 12: 75,963,813 L2499P probably damaging Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tab2 C T 10: 7,920,119 V126I probably damaging Het
Tecpr1 T C 5: 144,211,499 T363A probably damaging Het
Terb2 A G 2: 122,186,335 D16G probably benign Het
Tm2d2 A G 8: 25,020,536 E137G probably benign Het
Trim30d T A 7: 104,472,485 H201L probably damaging Het
Tspan3 A G 9: 56,147,385 probably null Het
Ttn A T 2: 76,787,323 L16268Q probably damaging Het
Ttn A T 2: 76,796,185 probably null Het
Ubap2 T A 4: 41,218,319 T263S probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zeb2 A T 2: 44,996,126 M973K possibly damaging Het
Zfp229 A G 17: 21,746,634 E615G probably damaging Het
Zfp655 T A 5: 145,244,057 S242T possibly damaging Het
Zfp788 T A 7: 41,648,281 F62I possibly damaging Het
Zmynd8 A G 2: 165,787,158 probably null Het
Other mutations in Cysltr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Cysltr1 APN X 106578736 missense probably damaging 1.00
IGL02481:Cysltr1 APN X 106578122 missense probably damaging 0.98
IGL02483:Cysltr1 APN X 106578122 missense probably damaging 0.98
R0463:Cysltr1 UTSW X 106578655 missense possibly damaging 0.91
X0063:Cysltr1 UTSW X 106578527 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CTGGACTGGAAAGACAATTGCAACAC -3'
(R):5'- GCAGACATTCCTGGAGAACATGAATGG -3'

Sequencing Primer
(F):5'- CGGAAAAAGCTCATGGCTGTC -3'
(R):5'- TGGAACTGAAAATCTGACGACATC -3'
Posted On2013-07-11