Incidental Mutation 'R7002:Zfp236'
ID544636
Institutional Source Beutler Lab
Gene Symbol Zfp236
Ensembl Gene ENSMUSG00000041258
Gene Namezinc finger protein 236
SynonymsLOC240456
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock #R7002 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location82593593-82692883 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 82691576 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171071] [ENSMUST00000182122] [ENSMUST00000182866] [ENSMUST00000183048]
Predicted Effect probably benign
Transcript: ENSMUST00000171071
SMART Domains Protein: ENSMUSP00000130004
Gene: ENSMUSG00000041258

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
low complexity region 290 309 N/A INTRINSIC
low complexity region 403 426 N/A INTRINSIC
ZnF_C2H2 436 458 1.98e-4 SMART
ZnF_C2H2 464 486 9.58e-3 SMART
ZnF_C2H2 492 514 6.42e-4 SMART
ZnF_C2H2 520 542 1.18e-2 SMART
low complexity region 592 605 N/A INTRINSIC
ZnF_C2H2 611 633 1.62e0 SMART
ZnF_C2H2 639 661 5.21e-4 SMART
ZnF_C2H2 667 689 6.78e-3 SMART
ZnF_C2H2 695 717 7.37e-4 SMART
low complexity region 720 733 N/A INTRINSIC
ZnF_C2H2 922 944 5.21e-4 SMART
ZnF_C2H2 950 972 1.04e-3 SMART
ZnF_C2H2 978 1000 8.6e-5 SMART
ZnF_C2H2 1006 1028 2.75e-3 SMART
low complexity region 1030 1039 N/A INTRINSIC
ZnF_C2H2 1122 1144 7.78e-3 SMART
ZnF_C2H2 1150 1172 3.63e-3 SMART
ZnF_C2H2 1178 1200 6.88e-4 SMART
ZnF_C2H2 1206 1228 5.42e-2 SMART
low complexity region 1243 1258 N/A INTRINSIC
low complexity region 1462 1477 N/A INTRINSIC
ZnF_C2H2 1612 1635 7.15e-2 SMART
ZnF_C2H2 1641 1663 2.91e-2 SMART
ZnF_C2H2 1677 1699 7.26e-3 SMART
ZnF_C2H2 1705 1727 1.84e-4 SMART
ZnF_C2H2 1733 1756 2.95e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181931
Predicted Effect probably benign
Transcript: ENSMUST00000182122
SMART Domains Protein: ENSMUSP00000138557
Gene: ENSMUSG00000041258

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
ZnF_C2H2 287 310 9.58e-3 SMART
low complexity region 338 357 N/A INTRINSIC
low complexity region 451 474 N/A INTRINSIC
ZnF_C2H2 484 506 1.98e-4 SMART
ZnF_C2H2 512 534 9.58e-3 SMART
ZnF_C2H2 540 562 6.42e-4 SMART
ZnF_C2H2 568 590 1.18e-2 SMART
low complexity region 640 653 N/A INTRINSIC
ZnF_C2H2 659 681 1.62e0 SMART
ZnF_C2H2 687 709 5.21e-4 SMART
ZnF_C2H2 715 737 6.78e-3 SMART
ZnF_C2H2 743 765 7.37e-4 SMART
low complexity region 768 781 N/A INTRINSIC
ZnF_C2H2 970 992 5.21e-4 SMART
ZnF_C2H2 998 1020 1.04e-3 SMART
ZnF_C2H2 1026 1048 8.6e-5 SMART
ZnF_C2H2 1054 1076 2.75e-3 SMART
low complexity region 1078 1087 N/A INTRINSIC
ZnF_C2H2 1170 1192 7.78e-3 SMART
ZnF_C2H2 1198 1220 3.63e-3 SMART
ZnF_C2H2 1226 1248 6.88e-4 SMART
ZnF_C2H2 1254 1276 5.42e-2 SMART
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1510 1525 N/A INTRINSIC
ZnF_C2H2 1660 1683 7.15e-2 SMART
ZnF_C2H2 1689 1711 2.91e-2 SMART
ZnF_C2H2 1725 1747 7.26e-3 SMART
ZnF_C2H2 1753 1775 1.84e-4 SMART
ZnF_C2H2 1781 1804 2.95e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182866
SMART Domains Protein: ENSMUSP00000138344
Gene: ENSMUSG00000041258

DomainStartEndE-ValueType
ZnF_C2H2 23 45 2.24e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183048
SMART Domains Protein: ENSMUSP00000138179
Gene: ENSMUSG00000041258

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
ZnF_C2H2 287 310 9.58e-3 SMART
low complexity region 338 357 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Meta Mutation Damage Score 0.6384 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,941,564 S1308P probably damaging Het
Adam6b C A 12: 113,489,707 S48* probably null Het
Adamts18 T A 8: 113,775,290 D313V possibly damaging Het
Aoc1 A G 6: 48,905,876 S229G probably benign Het
Apol10a G A 15: 77,484,846 R15H possibly damaging Het
Bend4 T A 5: 67,398,259 T535S probably benign Het
Blm T C 7: 80,469,753 K1024R probably benign Het
Brca2 T C 5: 150,539,918 V1049A probably benign Het
Cerk T C 15: 86,156,594 Y188C possibly damaging Het
Cic C T 7: 25,272,196 R451C probably damaging Het
Col18a1 A T 10: 77,166,343 V10E unknown Het
Cplx1 T A 5: 108,520,316 K58M probably damaging Het
Crybg1 T A 10: 43,998,835 D759V probably damaging Het
Cwc25 A T 11: 97,748,071 N342K probably damaging Het
Dab2 A T 15: 6,435,365 T566S probably benign Het
Dip2b T A 15: 100,160,465 N408K probably benign Het
Dnah12 T C 14: 26,876,998 I3631T probably damaging Het
Dnase1 A G 16: 4,039,546 I236V possibly damaging Het
Duox1 C T 2: 122,319,877 Q196* probably null Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Erich5 C T 15: 34,471,362 L246F probably damaging Het
Frmpd1 C T 4: 45,284,200 A1007V probably benign Het
Fsip2 T A 2: 82,989,343 I5140N possibly damaging Het
Gan T C 8: 117,195,847 C440R possibly damaging Het
Garnl3 T A 2: 33,054,193 H73L possibly damaging Het
Gid8 T G 2: 180,713,303 M34R possibly damaging Het
Gjd4 C A 18: 9,280,960 L39F possibly damaging Het
Gm5868 T A 5: 72,586,420 probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grhpr T C 4: 44,990,427 S306P probably damaging Het
Hdac4 T G 1: 91,968,361 K729T possibly damaging Het
Hist2h2be A G 3: 96,221,373 I70V probably benign Het
Igfbp2 C T 1: 72,849,645 H85Y probably damaging Het
Igkv4-61 T G 6: 69,417,389 I13L probably benign Het
Il18r1 G A 1: 40,474,853 S73N probably benign Het
Immt T C 6: 71,861,040 V244A probably damaging Het
Irs1 T C 1: 82,288,260 Y745C probably benign Het
Itpr3 T C 17: 27,110,580 V1526A probably benign Het
Jrkl A T 9: 13,245,521 I45K probably damaging Het
Lamp3 G T 16: 19,655,422 Q401K possibly damaging Het
Lrrfip1 T A 1: 91,115,458 H528Q probably benign Het
Ltn1 A T 16: 87,423,473 D245E probably benign Het
Mnat1 T C 12: 73,230,705 probably benign Het
Mpp6 C T 6: 50,162,662 P116L probably benign Het
Mprip A C 11: 59,761,190 M1907L probably benign Het
Mut T A 17: 40,941,383 I272N possibly damaging Het
Nfu1 C A 6: 87,016,272 H131Q probably benign Het
Nup188 T A 2: 30,323,568 S670R probably damaging Het
Olfr1090 T C 2: 86,754,681 D19G probably benign Het
Olfr1477 A G 19: 13,502,675 N111D probably benign Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pbrm1 T A 14: 31,064,820 D631E probably benign Het
Rnf13 A G 3: 57,833,612 N274S probably damaging Het
Rtl1 T A 12: 109,593,947 Y486F probably damaging Het
Sec14l3 A T 11: 4,075,263 H291L possibly damaging Het
Senp5 A G 16: 31,983,775 S532P probably damaging Het
Sepsecs T C 5: 52,647,208 probably null Het
Serpina1e T C 12: 103,948,079 I329V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,034 unknown Het
Smc5 A G 19: 23,231,883 V639A probably benign Het
Speg T A 1: 75,423,268 V2453E probably damaging Het
Syt2 T A 1: 134,744,104 F207I probably damaging Het
Tchp C T 5: 114,708,796 S48L probably benign Het
Trim12a A G 7: 104,304,176 S243P possibly damaging Het
Ttn T C 2: 76,798,217 E14533G probably damaging Het
Vmn1r50 T A 6: 90,107,837 M188K probably benign Het
Vps11 G A 9: 44,355,079 T437I probably damaging Het
Xrn1 C T 9: 96,047,790 T1498I probably benign Het
Zfp316 T C 5: 143,263,355 D175G unknown Het
Zmynd11 A G 13: 9,694,330 L256P probably damaging Het
Other mutations in Zfp236
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Zfp236 APN 18 82668690 missense probably benign 0.44
IGL01760:Zfp236 APN 18 82621422 missense probably damaging 1.00
IGL01923:Zfp236 APN 18 82682219 missense probably damaging 0.98
IGL01934:Zfp236 APN 18 82633120 missense probably damaging 0.99
IGL01949:Zfp236 APN 18 82624396 missense probably damaging 1.00
IGL02063:Zfp236 APN 18 82658151 missense probably benign
IGL02496:Zfp236 APN 18 82629992 missense probably damaging 1.00
IGL02513:Zfp236 APN 18 82630114 missense probably damaging 1.00
IGL02626:Zfp236 APN 18 82657995 splice site probably benign
IGL02880:Zfp236 APN 18 82624459 missense probably benign 0.15
IGL03156:Zfp236 APN 18 82680702 missense probably damaging 1.00
IGL03261:Zfp236 APN 18 82630608 missense possibly damaging 0.93
R0047:Zfp236 UTSW 18 82680692 missense probably damaging 1.00
R0052:Zfp236 UTSW 18 82639332 missense probably damaging 1.00
R0194:Zfp236 UTSW 18 82656987 missense probably damaging 1.00
R0207:Zfp236 UTSW 18 82640227 missense probably damaging 1.00
R0234:Zfp236 UTSW 18 82629994 missense probably damaging 1.00
R0234:Zfp236 UTSW 18 82629994 missense probably damaging 1.00
R0302:Zfp236 UTSW 18 82658088 missense probably damaging 0.99
R0730:Zfp236 UTSW 18 82640244 splice site probably benign
R0755:Zfp236 UTSW 18 82620332 missense probably damaging 1.00
R1202:Zfp236 UTSW 18 82628166 missense probably benign 0.00
R1449:Zfp236 UTSW 18 82646005 missense probably damaging 1.00
R1550:Zfp236 UTSW 18 82674424 missense possibly damaging 0.81
R1785:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R1786:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2042:Zfp236 UTSW 18 82633109 missense probably damaging 1.00
R2132:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2133:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2247:Zfp236 UTSW 18 82604298 missense possibly damaging 0.82
R2484:Zfp236 UTSW 18 82668637 missense probably benign 0.05
R3715:Zfp236 UTSW 18 82632970 splice site probably benign
R4003:Zfp236 UTSW 18 82680745 nonsense probably null
R4031:Zfp236 UTSW 18 82624465 missense probably damaging 1.00
R4482:Zfp236 UTSW 18 82644221 missense probably benign 0.04
R4492:Zfp236 UTSW 18 82630000 missense probably damaging 1.00
R4502:Zfp236 UTSW 18 82636954 missense probably benign 0.13
R4561:Zfp236 UTSW 18 82620406 missense probably damaging 1.00
R4649:Zfp236 UTSW 18 82597659 missense probably damaging 1.00
R4902:Zfp236 UTSW 18 82609418 missense possibly damaging 0.89
R5064:Zfp236 UTSW 18 82691576 critical splice donor site probably null
R5084:Zfp236 UTSW 18 82609431 missense probably damaging 1.00
R5090:Zfp236 UTSW 18 82618881 missense probably benign 0.08
R5191:Zfp236 UTSW 18 82621423 missense probably damaging 1.00
R5264:Zfp236 UTSW 18 82630094 missense probably damaging 1.00
R5264:Zfp236 UTSW 18 82658073 missense probably damaging 0.99
R5339:Zfp236 UTSW 18 82624366 missense probably damaging 0.99
R5375:Zfp236 UTSW 18 82597688 missense possibly damaging 0.93
R5445:Zfp236 UTSW 18 82682156 missense probably benign 0.02
R5513:Zfp236 UTSW 18 82658022 missense probably damaging 0.97
R5527:Zfp236 UTSW 18 82658034 missense possibly damaging 0.51
R5628:Zfp236 UTSW 18 82657122 missense probably damaging 1.00
R5758:Zfp236 UTSW 18 82671709 missense probably damaging 1.00
R5890:Zfp236 UTSW 18 82640151 missense possibly damaging 0.87
R6137:Zfp236 UTSW 18 82671794 missense possibly damaging 0.89
R6193:Zfp236 UTSW 18 82604247 missense probably damaging 1.00
R6198:Zfp236 UTSW 18 82657153 missense probably damaging 1.00
R6239:Zfp236 UTSW 18 82657104 missense possibly damaging 0.53
R6705:Zfp236 UTSW 18 82633737 missense probably damaging 0.97
R6948:Zfp236 UTSW 18 82644062 missense possibly damaging 0.94
R6989:Zfp236 UTSW 18 82628363 missense probably damaging 1.00
R7113:Zfp236 UTSW 18 82620337 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTGCTGACTTTGTGAAGAGC -3'
(R):5'- ACGTGCCTGGGTTTAGTCTC -3'

Sequencing Primer
(F):5'- GAGCAACAGCAGTACTTTGC -3'
(R):5'- CAGTCTCAGTCTTGGGTAATACCTG -3'
Posted On2019-05-13