Incidental Mutation 'R7003:Polr3c'
ID544649
Institutional Source Beutler Lab
Gene Symbol Polr3c
Ensembl Gene ENSMUSG00000028099
Gene Namepolymerase (RNA) III (DNA directed) polypeptide C
Synonyms4933407E01Rik, RPC62, RPC3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R7003 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96711490-96727628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 96723638 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 155 (H155Q)
Ref Sequence ENSEMBL: ENSMUSP00000115300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029740] [ENSMUST00000029741] [ENSMUST00000125183] [ENSMUST00000141377] [ENSMUST00000154679] [ENSMUST00000199051]
Predicted Effect probably benign
Transcript: ENSMUST00000029740
SMART Domains Protein: ENSMUSP00000029740
Gene: ENSMUSG00000028098

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RING 229 269 1.14e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000029741
AA Change: H155Q

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029741
Gene: ENSMUSG00000028099
AA Change: H155Q

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 9.4e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125183
SMART Domains Protein: ENSMUSP00000123513
Gene: ENSMUSG00000028099

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 4.6e-29 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119236
Gene: ENSMUSG00000028099
AA Change: H28Q

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc82 20 180 5.9e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000141377
AA Change: H155Q

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115300
Gene: ENSMUSG00000028099
AA Change: H155Q

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 3.3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000154679
AA Change: H155Q

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122435
Gene: ENSMUSG00000028099
AA Change: H155Q

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 1.6e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199051
SMART Domains Protein: ENSMUSP00000143321
Gene: ENSMUSG00000028098

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:zf-RING_3 18 49 4.5e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,228,762 L2164R probably damaging Het
Actbl2 T A 13: 111,255,956 I275N probably damaging Het
Actr3b A C 5: 25,798,463 Y21S probably damaging Het
Adam6b C T 12: 113,490,042 Q160* probably null Het
Adgrv1 C T 13: 81,522,104 probably null Het
Akr1c6 A G 13: 4,454,515 N300D probably benign Het
Alox8 T C 11: 69,191,590 D170G possibly damaging Het
Amhr2 A G 15: 102,446,333 N40S probably benign Het
Ap2a2 A G 7: 141,629,196 N767S probably benign Het
Armc3 T C 2: 19,270,028 I358T probably damaging Het
Atg2b A G 12: 105,654,249 S732P probably benign Het
Atp12a A G 14: 56,373,380 Y327C possibly damaging Het
Bcr T C 10: 75,061,561 V179A probably benign Het
Cep104 T C 4: 153,993,561 L642P probably benign Het
Clspn T A 4: 126,592,720 S1302R possibly damaging Het
Cmip T C 8: 117,384,988 F153L probably benign Het
D630039A03Rik T C 4: 57,910,521 D97G probably damaging Het
Dok7 A T 5: 35,079,555 T396S probably benign Het
Dsel C T 1: 111,860,295 V837I probably benign Het
Etl4 C T 2: 20,805,884 T926I probably benign Het
Gm7102 A G 19: 61,175,881 S39P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gpr155 A G 2: 73,343,617 I816T probably damaging Het
Hpn C T 7: 31,110,942 probably benign Het
Inpp5e A G 2: 26,397,865 S640P probably benign Het
Irs3 C T 5: 137,645,277 V82I probably benign Het
Kif16b A C 2: 142,758,829 D461E possibly damaging Het
Krba1 A G 6: 48,413,080 T592A possibly damaging Het
Lgsn T A 1: 31,203,943 S369T possibly damaging Het
Lrrc4b C T 7: 44,445,156 P83S probably damaging Het
Neil3 T C 8: 53,600,966 T343A possibly damaging Het
Nt5e A G 9: 88,364,752 Y347C probably damaging Het
Olfr1532-ps1 A T 7: 106,915,112 T305S probably benign Het
Olfr3 A G 2: 36,813,035 I19T possibly damaging Het
Olfr452 C T 6: 42,790,465 T142I probably benign Het
Olfr943 A T 9: 39,184,943 Y255F probably benign Het
P2rx5 T C 11: 73,167,974 probably null Het
Phtf2 A G 5: 20,794,401 V248A probably benign Het
Plekhd1 T C 12: 80,721,960 C406R possibly damaging Het
Plod3 T A 5: 136,989,644 N245K probably damaging Het
Psap T A 10: 60,299,497 C317S probably damaging Het
Rif1 A G 2: 52,076,989 I97V probably benign Het
Rnf123 T A 9: 108,063,683 probably null Het
Rnf19a G A 15: 36,254,504 R303* probably null Het
Sdk1 G A 5: 142,096,734 V1036I probably benign Het
Shc3 T A 13: 51,466,552 Y146F probably benign Het
Skint6 A G 4: 113,105,912 Y441H probably benign Het
Slc7a12 T C 3: 14,505,520 I173T probably damaging Het
Spesp1 A T 9: 62,282,020 S15T possibly damaging Het
Tarm1 A T 7: 3,497,423 probably null Het
Tenm3 T C 8: 48,240,444 Y1817C probably damaging Het
Ttc9c A T 19: 8,818,540 L45Q probably damaging Het
Ube3a C T 7: 59,276,440 T322I probably damaging Het
Vac14 T A 8: 110,712,798 V669E probably damaging Het
Vmn1r225 A G 17: 20,503,154 M286V probably null Het
Zfp658 A G 7: 43,574,748 K816E possibly damaging Het
Zfp846 T C 9: 20,587,892 M1T probably null Het
Other mutations in Polr3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Polr3c APN 3 96713520 missense probably damaging 1.00
IGL01904:Polr3c APN 3 96716665 critical splice donor site probably null
IGL01964:Polr3c APN 3 96711975 unclassified probably benign
IGL02640:Polr3c APN 3 96716686 missense probably damaging 0.98
IGL02955:Polr3c APN 3 96714312 missense probably damaging 1.00
IGL03129:Polr3c APN 3 96719454 splice site probably benign
IGL03263:Polr3c APN 3 96714251 splice site probably benign
R0503:Polr3c UTSW 3 96713636 splice site probably null
R0800:Polr3c UTSW 3 96719311 missense probably damaging 0.99
R0881:Polr3c UTSW 3 96723847 missense probably damaging 0.99
R1763:Polr3c UTSW 3 96713595 missense probably damaging 1.00
R1931:Polr3c UTSW 3 96719298 missense probably damaging 1.00
R1932:Polr3c UTSW 3 96719298 missense probably damaging 1.00
R1994:Polr3c UTSW 3 96714373 splice site probably null
R3771:Polr3c UTSW 3 96725854 missense probably damaging 1.00
R4116:Polr3c UTSW 3 96715244 missense probably damaging 1.00
R4614:Polr3c UTSW 3 96716471 missense probably benign 0.00
R4732:Polr3c UTSW 3 96723661 missense probably damaging 1.00
R4733:Polr3c UTSW 3 96723661 missense probably damaging 1.00
R5057:Polr3c UTSW 3 96712057 missense probably damaging 0.98
R5058:Polr3c UTSW 3 96723517 missense probably benign 0.01
R5756:Polr3c UTSW 3 96714134 missense probably damaging 1.00
R6005:Polr3c UTSW 3 96719468 missense possibly damaging 0.96
R6009:Polr3c UTSW 3 96713614 missense probably damaging 1.00
R6580:Polr3c UTSW 3 96727343 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGAAGAGTCCCCAATTAAGGC -3'
(R):5'- TCCTGCTGAATGGCAAAATGAC -3'

Sequencing Primer
(F):5'- CCCAATTAAGGCAAATCAGCTTTAGG -3'
(R):5'- ACAATGTCAGCTGTTGTGAAG -3'
Posted On2019-05-13