Incidental Mutation 'R7006:Zfp180'
ID544719
Institutional Source Beutler Lab
Gene Symbol Zfp180
Ensembl Gene ENSMUSG00000057101
Gene Namezinc finger protein 180
SynonymsHHZ168, 2310040I01Rik, D130011P11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R7006 (G1)
Quality Score179.009
Status Not validated
Chromosome7
Chromosomal Location24081924-24107713 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 24105112 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 319 (E319*)
Ref Sequence ENSEMBL: ENSMUSP00000064611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068975] [ENSMUST00000203854] [ENSMUST00000206184] [ENSMUST00000207002]
Predicted Effect probably null
Transcript: ENSMUST00000068975
AA Change: E319*
SMART Domains Protein: ENSMUSP00000064611
Gene: ENSMUSG00000057101
AA Change: E319*

DomainStartEndE-ValueType
Blast:KRAB 46 103 7e-14 BLAST
ZnF_C2H2 318 340 3.21e-4 SMART
ZnF_C2H2 346 368 3.39e-3 SMART
ZnF_C2H2 374 396 1.72e-4 SMART
ZnF_C2H2 402 424 4.87e-4 SMART
ZnF_C2H2 430 452 1.58e-3 SMART
ZnF_C2H2 458 480 5.99e-4 SMART
ZnF_C2H2 486 508 2.12e-4 SMART
ZnF_C2H2 514 536 1.6e-4 SMART
ZnF_C2H2 542 564 3.95e-4 SMART
ZnF_C2H2 570 592 5.9e-3 SMART
ZnF_C2H2 598 620 1.12e-3 SMART
ZnF_C2H2 626 648 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203854
SMART Domains Protein: ENSMUSP00000145165
Gene: ENSMUSG00000057101

DomainStartEndE-ValueType
Blast:KRAB 12 69 4e-14 BLAST
ZnF_C2H2 284 306 3.21e-4 SMART
ZnF_C2H2 312 334 3.39e-3 SMART
ZnF_C2H2 340 362 1.72e-4 SMART
ZnF_C2H2 368 390 4.87e-4 SMART
ZnF_C2H2 396 418 1.58e-3 SMART
ZnF_C2H2 424 446 5.99e-4 SMART
ZnF_C2H2 452 474 2.12e-4 SMART
ZnF_C2H2 480 502 1.6e-4 SMART
ZnF_C2H2 508 530 3.95e-4 SMART
ZnF_C2H2 536 558 5.9e-3 SMART
ZnF_C2H2 564 586 1.12e-3 SMART
ZnF_C2H2 592 614 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206184
Predicted Effect probably benign
Transcript: ENSMUST00000207002
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See MIM 604749 for additional information on zinc finger proteins.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 G A 13: 68,888,020 T174M probably damaging Het
Ankfy1 T A 11: 72,740,464 I412N probably benign Het
AW146154 T C 7: 41,481,224 E156G possibly damaging Het
B4galnt1 T C 10: 127,169,831 L267P probably benign Het
Bod1l T C 5: 41,832,552 E276G probably damaging Het
Ccdc187 T C 2: 26,281,090 T459A probably benign Het
Cep72 G A 13: 74,050,308 Q311* probably null Het
Cir1 T C 2: 73,310,490 Q45R probably damaging Het
Ciz1 T C 2: 32,371,115 probably null Het
Crtap G T 9: 114,386,323 A166E probably damaging Het
Dmp1 A G 5: 104,212,322 D288G probably benign Het
Dusp27 T C 1: 166,099,094 N983S probably benign Het
Fam69a A G 5: 107,910,161 V132A probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmnl2 C A 2: 53,108,254 Q544K probably benign Het
Gm13178 A G 4: 144,721,283 V41A probably benign Het
Gm6657 T A 12: 78,208,928 *177R probably null Het
Gpsm1 T C 2: 26,322,560 L72P probably damaging Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Kcnq3 A C 15: 66,020,316 Y403* probably null Het
Kcp A C 6: 29,499,170 Y298D probably damaging Het
Kif5c T C 2: 49,735,514 S599P probably damaging Het
Krt20 A T 11: 99,437,761 Y113N probably benign Het
Mcm8 T G 2: 132,823,261 V191G probably damaging Het
Msr1 T A 8: 39,589,382 D384V probably damaging Het
Mtpap A C 18: 4,380,873 S184R possibly damaging Het
Npc1l1 G A 11: 6,217,731 T1020M probably benign Het
Nphp4 A G 4: 152,488,802 T66A probably benign Het
Olfr1049 T A 2: 86,255,228 Q155L probably benign Het
Olfr1100 G A 2: 86,977,959 T279I probably damaging Het
Olfr1306 C A 2: 111,912,256 V225L probably benign Het
Olfr98 T A 17: 37,262,734 *310L probably null Het
Phf11d G T 14: 59,353,374 T178K probably benign Het
Ppm1d A G 11: 85,337,151 K298E possibly damaging Het
Rab2b A T 14: 52,266,233 I144K probably benign Het
Stoml1 A G 9: 58,260,240 D5G probably damaging Het
Tanc1 T C 2: 59,795,844 V515A probably damaging Het
Tas1r3 A G 4: 155,862,904 V108A possibly damaging Het
Tcrg-C4 T A 13: 19,344,825 probably benign Het
Tifab T C 13: 56,176,246 Y128C probably benign Het
Tmc6 G T 11: 117,774,257 R397S probably damaging Het
Tnpo3 C T 6: 29,589,163 A63T probably damaging Het
Usp16 G T 16: 87,471,836 C284F probably damaging Het
Wipf1 T C 2: 73,437,097 D319G probably damaging Het
Xpnpep3 T A 15: 81,442,448 W347R probably damaging Het
Other mutations in Zfp180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Zfp180 APN 7 24085469 missense probably damaging 0.98
IGL00990:Zfp180 APN 7 24104830 missense probably benign 0.42
IGL00990:Zfp180 APN 7 24104995 missense possibly damaging 0.60
IGL00990:Zfp180 APN 7 24104416 missense possibly damaging 0.83
IGL01061:Zfp180 APN 7 24104745 missense possibly damaging 0.50
IGL01328:Zfp180 APN 7 24101479 missense probably benign 0.01
IGL03134:Zfp180 UTSW 7 24104745 missense possibly damaging 0.50
R0137:Zfp180 UTSW 7 24105733 missense possibly damaging 0.93
R0390:Zfp180 UTSW 7 24104707 missense possibly damaging 0.95
R1451:Zfp180 UTSW 7 24105218 missense probably benign 0.00
R1534:Zfp180 UTSW 7 24101523 missense probably benign 0.31
R1555:Zfp180 UTSW 7 24101574 intron probably benign
R1577:Zfp180 UTSW 7 24105908 missense probably damaging 1.00
R1605:Zfp180 UTSW 7 24104624 missense probably benign 0.00
R1633:Zfp180 UTSW 7 24104801 missense probably benign 0.07
R1817:Zfp180 UTSW 7 24105227 missense probably damaging 1.00
R2012:Zfp180 UTSW 7 24104518 missense probably benign 0.01
R2076:Zfp180 UTSW 7 24105103 missense probably damaging 1.00
R2151:Zfp180 UTSW 7 24105260 missense probably damaging 1.00
R2262:Zfp180 UTSW 7 24104624 missense probably benign 0.32
R3081:Zfp180 UTSW 7 24105503 missense probably damaging 1.00
R3402:Zfp180 UTSW 7 24105745 missense probably benign 0.30
R4551:Zfp180 UTSW 7 24104573 missense possibly damaging 0.87
R4747:Zfp180 UTSW 7 24105821 missense probably damaging 1.00
R4983:Zfp180 UTSW 7 24106078 missense probably damaging 0.98
R5610:Zfp180 UTSW 7 24104890 missense probably benign 0.00
R5764:Zfp180 UTSW 7 24101484 missense possibly damaging 0.71
R5987:Zfp180 UTSW 7 24105434 missense probably damaging 1.00
R6207:Zfp180 UTSW 7 24105085 nonsense probably null
R6247:Zfp180 UTSW 7 24105105 missense probably damaging 1.00
R6328:Zfp180 UTSW 7 24105556 missense probably damaging 1.00
R6708:Zfp180 UTSW 7 24106096 missense probably damaging 0.98
R6814:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R6872:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R7084:Zfp180 UTSW 7 24105261 missense probably damaging 1.00
R7101:Zfp180 UTSW 7 24104533 missense probably benign 0.00
R7213:Zfp180 UTSW 7 24104513 missense possibly damaging 0.87
R7263:Zfp180 UTSW 7 24105700 nonsense probably null
R7360:Zfp180 UTSW 7 24105490 missense probably damaging 1.00
R7487:Zfp180 UTSW 7 24106100 missense probably damaging 1.00
V5622:Zfp180 UTSW 7 24082031 start gained probably benign
X0067:Zfp180 UTSW 7 24105472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCGCCCCGAAATCTAAATG -3'
(R):5'- TTTGTAGCTCTGGCGGAAC -3'

Sequencing Primer
(F):5'- GCCCCGAAATCTAAATGAGAAAGTTC -3'
(R):5'- GTGAGTTCTCTGATGCACCACAAG -3'
Posted On2019-05-13