Incidental Mutation 'R7006:B4galnt1'
ID544725
Institutional Source Beutler Lab
Gene Symbol B4galnt1
Ensembl Gene ENSMUSG00000006731
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 1
SynonymsGgm2, Gal-NAc-T, GalNAcT, beta1,4GalNAC-T, GalNAc-T, Ggm-2, GM2/GD2 synthase, 4933429D13Rik, Galgt1
MMRRC Submission
Accession Numbers

Genbank: NM_008080; MGI: 1342057  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7006 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127165225-127172330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127169831 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 267 (L267P)
Ref Sequence ENSEMBL: ENSMUSP00000006914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006914] [ENSMUST00000095270] [ENSMUST00000217678] [ENSMUST00000222911]
Predicted Effect probably benign
Transcript: ENSMUST00000006914
AA Change: L267P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006914
Gene: ENSMUSG00000006731
AA Change: L267P

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
Pfam:Glycos_transf_2 280 450 7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095270
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217678
Predicted Effect probably benign
Transcript: ENSMUST00000222911
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GM2 and GD2 gangliosides are sialic acid-containing glycosphingolipids. GalNAc-T is the enzyme involved in the biosynthesis of G(M2) and G(D2) glycosphingolipids. GalNAc-T catalyzes the transfer of GalNAc into G(M3) and G(D3) by a beta-1,4 linkage, resulting in the synthesis of G(M2) and G(D2), respectively. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for one knock-out allele lack all complex gangliosides but show normal brain histology and gross behavior with only subtle defects in neural conduction velocities. Mice homozygous for another knock-out allele exhibit male infertility due to degeneration of the seminiferous tubules. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 G A 13: 68,888,020 T174M probably damaging Het
Ankfy1 T A 11: 72,740,464 I412N probably benign Het
AW146154 T C 7: 41,481,224 E156G possibly damaging Het
Bod1l T C 5: 41,832,552 E276G probably damaging Het
Ccdc187 T C 2: 26,281,090 T459A probably benign Het
Cep72 G A 13: 74,050,308 Q311* probably null Het
Cir1 T C 2: 73,310,490 Q45R probably damaging Het
Ciz1 T C 2: 32,371,115 probably null Het
Crtap G T 9: 114,386,323 A166E probably damaging Het
Dmp1 A G 5: 104,212,322 D288G probably benign Het
Dusp27 T C 1: 166,099,094 N983S probably benign Het
Fam69a A G 5: 107,910,161 V132A probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmnl2 C A 2: 53,108,254 Q544K probably benign Het
Gm13178 A G 4: 144,721,283 V41A probably benign Het
Gm6657 T A 12: 78,208,928 *177R probably null Het
Gpsm1 T C 2: 26,322,560 L72P probably damaging Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Kcnq3 A C 15: 66,020,316 Y403* probably null Het
Kcp A C 6: 29,499,170 Y298D probably damaging Het
Kif5c T C 2: 49,735,514 S599P probably damaging Het
Krt20 A T 11: 99,437,761 Y113N probably benign Het
Mcm8 T G 2: 132,823,261 V191G probably damaging Het
Msr1 T A 8: 39,589,382 D384V probably damaging Het
Mtpap A C 18: 4,380,873 S184R possibly damaging Het
Npc1l1 G A 11: 6,217,731 T1020M probably benign Het
Nphp4 A G 4: 152,488,802 T66A probably benign Het
Olfr1049 T A 2: 86,255,228 Q155L probably benign Het
Olfr1100 G A 2: 86,977,959 T279I probably damaging Het
Olfr1306 C A 2: 111,912,256 V225L probably benign Het
Olfr98 T A 17: 37,262,734 *310L probably null Het
Phf11d G T 14: 59,353,374 T178K probably benign Het
Ppm1d A G 11: 85,337,151 K298E possibly damaging Het
Rab2b A T 14: 52,266,233 I144K probably benign Het
Stoml1 A G 9: 58,260,240 D5G probably damaging Het
Tanc1 T C 2: 59,795,844 V515A probably damaging Het
Tas1r3 A G 4: 155,862,904 V108A possibly damaging Het
Tcrg-C4 T A 13: 19,344,825 probably benign Het
Tifab T C 13: 56,176,246 Y128C probably benign Het
Tmc6 G T 11: 117,774,257 R397S probably damaging Het
Tnpo3 C T 6: 29,589,163 A63T probably damaging Het
Usp16 G T 16: 87,471,836 C284F probably damaging Het
Wipf1 T C 2: 73,437,097 D319G probably damaging Het
Xpnpep3 T A 15: 81,442,448 W347R probably damaging Het
Zfp180 G T 7: 24,105,112 E319* probably null Het
Other mutations in B4galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:B4galnt1 APN 10 127167764 missense probably benign 0.01
IGL01087:B4galnt1 APN 10 127166191 missense probably damaging 1.00
IGL01301:B4galnt1 APN 10 127169779 missense possibly damaging 0.56
IGL01924:B4galnt1 APN 10 127166761 missense probably benign 0.01
IGL02996:B4galnt1 APN 10 127167003 missense probably damaging 1.00
Hypokalemic UTSW 10 127171793 unclassified probably null
ANU18:B4galnt1 UTSW 10 127169779 missense possibly damaging 0.56
R0233:B4galnt1 UTSW 10 127170911 unclassified probably benign
R4646:B4galnt1 UTSW 10 127167836 missense probably damaging 0.99
R4702:B4galnt1 UTSW 10 127167525 missense possibly damaging 0.90
R4703:B4galnt1 UTSW 10 127167525 missense possibly damaging 0.90
R4705:B4galnt1 UTSW 10 127167525 missense possibly damaging 0.90
R4708:B4galnt1 UTSW 10 127169815 missense probably damaging 1.00
R5377:B4galnt1 UTSW 10 127171822 missense possibly damaging 0.95
R6644:B4galnt1 UTSW 10 127171793 unclassified probably null
R7278:B4galnt1 UTSW 10 127167788 missense probably benign 0.01
R7396:B4galnt1 UTSW 10 127171616 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTCAGAACGGTATGATCTTGCC -3'
(R):5'- TGGCAATGGTAACCAGAGCAC -3'

Sequencing Primer
(F):5'- CCACCAAGGCCTGAAAAGG -3'
(R):5'- ACCAGAGCACTGATGTTGTACTCG -3'
Posted On2019-05-13