Incidental Mutation 'R7006:Npc1l1'
ID544726
Institutional Source Beutler Lab
Gene Symbol Npc1l1
Ensembl Gene ENSMUSG00000020447
Gene NameNPC1 like intracellular cholesterol transporter 1
Synonyms9130221N23Rik, Niemann-Pick disease, type C1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7006 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location6211013-6230143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6217731 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1020 (T1020M)
Ref Sequence ENSEMBL: ENSMUSP00000004505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004505]
Predicted Effect probably benign
Transcript: ENSMUST00000004505
AA Change: T1020M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: T1020M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NPC1_N 28 283 8.7e-74 PFAM
low complexity region 294 307 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:Patched 385 897 4.7e-52 PFAM
Pfam:Sterol-sensing 661 815 5.7e-55 PFAM
Pfam:MMPL 665 830 2.3e-11 PFAM
Pfam:Patched 1063 1268 6.2e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 G A 13: 68,888,020 T174M probably damaging Het
Ankfy1 T A 11: 72,740,464 I412N probably benign Het
AW146154 T C 7: 41,481,224 E156G possibly damaging Het
B4galnt1 T C 10: 127,169,831 L267P probably benign Het
Bod1l T C 5: 41,832,552 E276G probably damaging Het
Ccdc187 T C 2: 26,281,090 T459A probably benign Het
Cep72 G A 13: 74,050,308 Q311* probably null Het
Cir1 T C 2: 73,310,490 Q45R probably damaging Het
Ciz1 T C 2: 32,371,115 probably null Het
Crtap G T 9: 114,386,323 A166E probably damaging Het
Dmp1 A G 5: 104,212,322 D288G probably benign Het
Dusp27 T C 1: 166,099,094 N983S probably benign Het
Fam69a A G 5: 107,910,161 V132A probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmnl2 C A 2: 53,108,254 Q544K probably benign Het
Gm13178 A G 4: 144,721,283 V41A probably benign Het
Gm6657 T A 12: 78,208,928 *177R probably null Het
Gpsm1 T C 2: 26,322,560 L72P probably damaging Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Kcnq3 A C 15: 66,020,316 Y403* probably null Het
Kcp A C 6: 29,499,170 Y298D probably damaging Het
Kif5c T C 2: 49,735,514 S599P probably damaging Het
Krt20 A T 11: 99,437,761 Y113N probably benign Het
Mcm8 T G 2: 132,823,261 V191G probably damaging Het
Msr1 T A 8: 39,589,382 D384V probably damaging Het
Mtpap A C 18: 4,380,873 S184R possibly damaging Het
Nphp4 A G 4: 152,488,802 T66A probably benign Het
Olfr1049 T A 2: 86,255,228 Q155L probably benign Het
Olfr1100 G A 2: 86,977,959 T279I probably damaging Het
Olfr1306 C A 2: 111,912,256 V225L probably benign Het
Olfr98 T A 17: 37,262,734 *310L probably null Het
Phf11d G T 14: 59,353,374 T178K probably benign Het
Ppm1d A G 11: 85,337,151 K298E possibly damaging Het
Rab2b A T 14: 52,266,233 I144K probably benign Het
Stoml1 A G 9: 58,260,240 D5G probably damaging Het
Tanc1 T C 2: 59,795,844 V515A probably damaging Het
Tas1r3 A G 4: 155,862,904 V108A possibly damaging Het
Tcrg-C4 T A 13: 19,344,825 probably benign Het
Tifab T C 13: 56,176,246 Y128C probably benign Het
Tmc6 G T 11: 117,774,257 R397S probably damaging Het
Tnpo3 C T 6: 29,589,163 A63T probably damaging Het
Usp16 G T 16: 87,471,836 C284F probably damaging Het
Wipf1 T C 2: 73,437,097 D319G probably damaging Het
Xpnpep3 T A 15: 81,442,448 W347R probably damaging Het
Zfp180 G T 7: 24,105,112 E319* probably null Het
Other mutations in Npc1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Npc1l1 APN 11 6224199 missense probably damaging 1.00
IGL01348:Npc1l1 APN 11 6227974 missense probably damaging 1.00
IGL01891:Npc1l1 APN 11 6214280 missense probably damaging 1.00
IGL01897:Npc1l1 APN 11 6227879 missense probably benign
IGL02098:Npc1l1 APN 11 6214581 missense probably damaging 0.99
IGL02121:Npc1l1 APN 11 6228157 missense probably benign
IGL02724:Npc1l1 APN 11 6214684 missense possibly damaging 0.88
IGL02947:Npc1l1 APN 11 6229246 missense probably benign 0.01
IGL03328:Npc1l1 APN 11 6218643 nonsense probably null
R0137:Npc1l1 UTSW 11 6228148 nonsense probably null
R0322:Npc1l1 UTSW 11 6229042 missense probably benign
R0352:Npc1l1 UTSW 11 6223076 missense probably benign 0.00
R0492:Npc1l1 UTSW 11 6223040 missense possibly damaging 0.82
R0918:Npc1l1 UTSW 11 6218239 missense probably damaging 1.00
R1300:Npc1l1 UTSW 11 6227859 missense probably damaging 1.00
R1455:Npc1l1 UTSW 11 6228174 missense possibly damaging 0.66
R1588:Npc1l1 UTSW 11 6217785 missense probably benign 0.01
R1803:Npc1l1 UTSW 11 6228846 missense probably damaging 1.00
R1882:Npc1l1 UTSW 11 6217473 splice site probably null
R1944:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6225199 nonsense probably null
R3155:Npc1l1 UTSW 11 6221840 missense probably benign
R4343:Npc1l1 UTSW 11 6217773 missense probably benign
R4504:Npc1l1 UTSW 11 6228741 missense possibly damaging 0.61
R4610:Npc1l1 UTSW 11 6228215 missense probably damaging 1.00
R4807:Npc1l1 UTSW 11 6218723 missense probably damaging 1.00
R4829:Npc1l1 UTSW 11 6214010 critical splice donor site probably null
R5135:Npc1l1 UTSW 11 6224245 missense possibly damaging 0.94
R5290:Npc1l1 UTSW 11 6222221 missense probably benign 0.00
R5369:Npc1l1 UTSW 11 6217705 critical splice donor site probably null
R5388:Npc1l1 UTSW 11 6214733 missense probably damaging 1.00
R5532:Npc1l1 UTSW 11 6224245 missense probably damaging 0.98
R5540:Npc1l1 UTSW 11 6214546 missense probably damaging 1.00
R5754:Npc1l1 UTSW 11 6227839 missense probably damaging 1.00
R5760:Npc1l1 UTSW 11 6229031 missense probably benign 0.02
R6057:Npc1l1 UTSW 11 6217806 missense possibly damaging 0.66
R6388:Npc1l1 UTSW 11 6224145 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214013 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214014 missense probably damaging 0.98
R6756:Npc1l1 UTSW 11 6215153 missense probably damaging 1.00
R6790:Npc1l1 UTSW 11 6214260 splice site probably null
R7062:Npc1l1 UTSW 11 6217807 missense probably benign
R7273:Npc1l1 UTSW 11 6218320 missense probably damaging 1.00
R7383:Npc1l1 UTSW 11 6217777 missense probably benign 0.30
X0022:Npc1l1 UTSW 11 6228058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGTTCTATACGCTGCTAGGC -3'
(R):5'- TTGGGCACAGAATGGGAGTC -3'

Sequencing Primer
(F):5'- TATACGCTGCTAGGCCCCTG -3'
(R):5'- AGTCAGGACAGGAGCTGCC -3'
Posted On2019-05-13