Incidental Mutation 'R7008:Cd2bp2'
ID544834
Institutional Source Beutler Lab
Gene Symbol Cd2bp2
Ensembl Gene ENSMUSG00000042502
Gene NameCD2 antigen (cytoplasmic tail) binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R7008 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location127191660-127196050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127195395 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 15 (D15G)
Ref Sequence ENSEMBL: ENSMUSP00000145634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035771] [ENSMUST00000120705] [ENSMUST00000166791] [ENSMUST00000205316] [ENSMUST00000205321] [ENSMUST00000205355] [ENSMUST00000206026] [ENSMUST00000206081] [ENSMUST00000206587]
Predicted Effect probably benign
Transcript: ENSMUST00000035771
AA Change: D15G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044790
Gene: ENSMUSG00000042502
AA Change: D15G

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120705
SMART Domains Protein: ENSMUSP00000113307
Gene: ENSMUSG00000042492

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Blast:TBC 274 305 6e-10 BLAST
TBC 343 557 8.23e-57 SMART
low complexity region 632 678 N/A INTRINSIC
coiled coil region 701 769 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166791
AA Change: D15G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132963
Gene: ENSMUSG00000042502
AA Change: D15G

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205316
AA Change: D15G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000205321
AA Change: D15G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205355
AA Change: D15G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000205620
Predicted Effect probably benign
Transcript: ENSMUST00000206026
AA Change: D15G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206081
AA Change: D15G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206587
AA Change: D15G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bi-functional protein. In the cytoplasm, the encoded protein binds the cytoplasmic tail of human surface antigen CD2 via its C-terminal GYF domain, and regulate CD2-triggered T lymphocyte activation. In the nucleus, this protein is a component of the U5 small nuclear ribonucleoprotein complex and is involved in RNA splicing. A pseudogene has been identified on chromosome 7. Alternative splicing results in multiple transcript variants but their biological validity has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T A 5: 90,260,096 I1421F possibly damaging Het
Arhgef11 C A 3: 87,729,218 T992K possibly damaging Het
Arid1b T C 17: 5,290,979 Y853H probably damaging Het
Bcl10 G T 3: 145,933,299 R232L probably benign Het
Best2 T A 8: 85,013,211 I76F possibly damaging Het
Card11 G C 5: 140,873,393 R1133G probably damaging Het
Card9 T C 2: 26,357,799 D180G possibly damaging Het
Ccdc162 T A 10: 41,552,415 E119V probably damaging Het
Cdk7 A C 13: 100,717,621 M120R probably damaging Het
Cryba4 T A 5: 112,251,782 T2S probably benign Het
Cyp19a1 A T 9: 54,193,325 M26K probably benign Het
Dgcr2 A G 16: 17,845,001 S157P probably damaging Het
Dis3l A G 9: 64,310,453 F782S possibly damaging Het
Ephb4 T A 5: 137,361,274 S369T probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8251 T C 1: 44,059,625 D771G probably benign Het
Hist1h1e T C 13: 23,622,209 K97E probably damaging Het
Igf2bp2 A T 16: 22,081,832 D118E probably benign Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Klhl5 T C 5: 65,143,249 S52P probably benign Het
Lrrc28 A T 7: 67,595,711 probably benign Het
Map4k4 T G 1: 39,988,971 D317E probably benign Het
Maz A T 7: 127,024,612 C66S probably damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Milr1 T A 11: 106,751,314 S11T probably damaging Het
Mthfd2l T A 5: 90,959,728 C150S probably damaging Het
Nemf A T 12: 69,341,621 N325K possibly damaging Het
Nemf C T 12: 69,353,793 probably null Het
Nod2 T A 8: 88,663,657 C197* probably null Het
Odf2l A G 3: 145,132,734 K241E probably damaging Het
Olfr1427 G A 19: 12,098,850 T263I possibly damaging Het
Olfr1489 A T 19: 13,633,621 N170I probably damaging Het
Osbpl10 T G 9: 115,061,848 D101E probably damaging Het
Osgin1 T C 8: 119,441,494 V20A possibly damaging Het
Pan3 T A 5: 147,545,693 C438S probably damaging Het
Plaa A G 4: 94,569,349 *795Q probably null Het
Prss35 T C 9: 86,756,308 V377A probably benign Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rdh16f1 A G 10: 127,790,906 H276R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sez6l T C 5: 112,464,695 Y460C probably damaging Het
Sipa1l1 T G 12: 82,363,112 M600R probably damaging Het
Slc11a2 T C 15: 100,409,324 Y92C probably damaging Het
Slc4a10 A G 2: 62,286,922 T712A probably benign Het
Sntb1 A T 15: 55,792,072 Y249* probably null Het
Spatc1 A G 15: 76,283,723 I127M probably benign Het
Synj1 A T 16: 90,993,945 N109K probably damaging Het
Tdg T A 10: 82,648,641 M396K possibly damaging Het
Tmem173 C A 18: 35,735,171 R292L probably damaging Het
Tmem252 T C 19: 24,674,292 V75A probably damaging Het
Trim40 T C 17: 36,883,976 Q142R probably damaging Het
Trip6 T C 5: 137,312,966 T163A probably damaging Het
Ttn T C 2: 76,894,642 probably benign Het
Wdr95 T C 5: 149,611,540 L721P probably benign Het
Zfp385c A T 11: 100,630,687 D182E probably damaging Het
Zfp597 A G 16: 3,865,767 F375S probably benign Het
Zfp658 T G 7: 43,573,912 F537C possibly damaging Het
Zgrf1 T C 3: 127,561,772 F216L probably benign Het
Other mutations in Cd2bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0020:Cd2bp2 UTSW 7 127193824 missense probably damaging 1.00
R0201:Cd2bp2 UTSW 7 127193828 missense probably damaging 1.00
R0550:Cd2bp2 UTSW 7 127193824 missense probably damaging 1.00
R0674:Cd2bp2 UTSW 7 127194836 missense probably damaging 1.00
R1929:Cd2bp2 UTSW 7 127193878 missense probably benign 0.22
R2187:Cd2bp2 UTSW 7 127194791 missense probably benign 0.06
R5877:Cd2bp2 UTSW 7 127194799 missense probably damaging 1.00
R6049:Cd2bp2 UTSW 7 127193835 missense probably damaging 1.00
R6109:Cd2bp2 UTSW 7 127194815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTTCCCCAGATACTCCAGG -3'
(R):5'- GCCTGCTAGTTCTCTCAGATGC -3'

Sequencing Primer
(F):5'- AGTTCCCCAGATACTCCAGGATCTG -3'
(R):5'- AGATGCTTTAGCGATCTGTCC -3'
Posted On2019-05-13