Incidental Mutation 'R7009:Cdh23'
ID544912
Institutional Source Beutler Lab
Gene Symbol Cdh23
Ensembl Gene ENSMUSG00000012819
Gene Namecadherin 23 (otocadherin)
Synonymsnmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R7009 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location60302748-60696490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60337306 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1700 (Y1700F)
Ref Sequence ENSEMBL: ENSMUSP00000101103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]
PDB Structure
Crystal structure of mouse cadherin-23 EC1 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE CADHERIN-23 EC1-2 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF NONSYNDROMIC DEAFNESS (DFNB12) ASSOCIATED MUTANT D124G OF MOUSE CADHERIN-23 EC1-2 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE CADHERIN-23 EC1-2 (ALL CATION BINDING SITES OCCUPIED BY CALCIUM) [X-RAY DIFFRACTION]
Structure of the N-terminus of Cadherin 23 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE CADHERIN-23 EC1-2 AND PROTOCADHERIN-15 EC1- 2 FORM I [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE CADHERIN-23 EC1-2 AND PROTOCADHERIN-15 EC1- 2 FORM II [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF DEAFNESS ASSOCIATED MUTANT MOUSE CADHERIN-23 EC1- 2D124G AND PROTOCADHERIN-15 EC1-2 FORM I [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF DEAFNESS ASSOCIATED MUTANT MOUSE CADHERIN-23 EC1- 2S70P AND PROTOCADHERIN-15 EC1-2 FORM I [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE CADHERIN-23 EC1-2 AND PROTOCADHERIN-15 EC1- 2, FORM I 2.2A. [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073242
AA Change: Y1699F

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: Y1699F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105461
AA Change: Y1700F

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: Y1700F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105462
AA Change: Y1702F

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: Y1702F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105463
AA Change: Y1700F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: Y1700F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105464
AA Change: Y1698F

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: Y1698F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 D69E possibly damaging Het
Abat A C 16: 8,602,367 M177L probably benign Het
Acadvl A G 11: 70,014,791 probably null Het
Adam5 T C 8: 24,806,438 N331S probably benign Het
Ager A G 17: 34,600,736 E372G probably damaging Het
Angpt1 T A 15: 42,523,595 Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 Q1131L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna2d3 A T 14: 28,969,365 M1K probably null Het
Ccdc18 G A 5: 108,173,862 probably null Het
Ccdc42 T C 11: 68,594,616 F267S probably damaging Het
Cenpe A T 3: 135,235,201 S704C probably damaging Het
Cenpe G A 3: 135,235,202 S704N probably benign Het
Cfap54 A T 10: 92,875,019 S2727T unknown Het
Clu T A 14: 65,971,832 V113D probably damaging Het
Cnbd2 A G 2: 156,320,034 I98V probably benign Het
Copa G T 1: 172,091,000 R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 probably null Het
Etnk1 T A 6: 143,203,154 probably null Het
Fnip1 A T 11: 54,502,935 K732N probably damaging Het
G6pd2 A G 5: 61,808,891 E3G probably benign Het
Gal3st2 A G 1: 93,873,759 T95A probably benign Het
Gapvd1 A G 2: 34,700,817 S948P probably damaging Het
Ggps1 A T 13: 14,054,165 Y8* probably null Het
Gria2 T C 3: 80,706,972 E587G probably damaging Het
Hpse T C 5: 100,692,279 E324G probably benign Het
Il16 G A 7: 83,646,388 T493I probably benign Het
Ints1 T C 5: 139,768,462 T652A possibly damaging Het
Ism1 A G 2: 139,757,279 I391V probably damaging Het
Katnb1 A G 8: 95,098,384 D598G probably damaging Het
Kif5c A G 2: 49,757,429 S880G probably benign Het
Klra8 T C 6: 130,125,184 N96S probably benign Het
Krt79 T A 15: 101,931,441 D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 R92Q probably benign Het
Lce1d C A 3: 92,686,046 C20F unknown Het
Limk1 T C 5: 134,672,699 T117A probably benign Het
Medag A T 5: 149,427,243 K61M probably benign Het
Mkrn3 T C 7: 62,419,618 M142V probably benign Het
Mob3c G A 4: 115,831,582 R104H probably benign Het
Morc1 G T 16: 48,627,070 R903L possibly damaging Het
Myh6 T C 14: 54,952,292 E1099G probably damaging Het
Nphp3 T G 9: 104,016,116 C434G probably null Het
Npr3 C T 15: 11,905,248 C131Y probably damaging Het
Oacyl C A 18: 65,722,538 Y112* probably null Het
Oprl1 A G 2: 181,718,381 T77A probably damaging Het
Osgep A G 14: 50,924,708 V24A probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 L922P probably benign Het
Phldb1 A G 9: 44,694,408 V375A probably damaging Het
Pip5k1b C T 19: 24,359,935 probably null Het
Psmd3 G A 11: 98,682,766 D13N probably benign Het
Ptprc G A 1: 138,064,553 H1140Y probably damaging Het
Ranbp3l A T 15: 9,062,984 H291L probably damaging Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 silent Het
Rin2 A C 2: 145,883,475 D794A probably damaging Het
Ripk1 A G 13: 34,030,062 I522M probably damaging Het
Rnf31 T C 14: 55,592,551 Y143H probably benign Het
Rp1 T G 1: 4,042,068 I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 V455A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a T G 9: 119,485,930 E1904A probably damaging Het
Sec16a G T 2: 26,436,002 S240* probably null Het
Slc22a8 C T 19: 8,605,417 T154I probably benign Het
Slc25a16 T A 10: 62,937,454 V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 S2T probably benign Het
Srd5a3 G A 5: 76,149,866 V48I probably benign Het
Srebf1 A C 11: 60,200,526 H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 K1310E probably benign Het
Swt1 A G 1: 151,370,630 V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 probably null Het
Tmem246 A T 4: 49,586,325 M281K probably benign Het
Trim45 A G 3: 100,931,879 probably benign Het
Tsen2 T A 6: 115,547,972 M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 C715* probably null Het
Vmn2r102 G A 17: 19,694,194 V674I probably damaging Het
Zfp87 A G 13: 67,517,054 S430P probably damaging Het
Other mutations in Cdh23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Cdh23 APN 10 60523548 missense probably benign 0.03
IGL00429:Cdh23 APN 10 60421141 missense probably damaging 0.97
IGL01014:Cdh23 APN 10 60307522 missense probably damaging 0.99
IGL01284:Cdh23 APN 10 60466097 missense possibly damaging 0.95
IGL01305:Cdh23 APN 10 60312624 missense probably damaging 1.00
IGL01367:Cdh23 APN 10 60310787 missense probably damaging 1.00
IGL01396:Cdh23 APN 10 60385069 missense possibly damaging 0.93
IGL01412:Cdh23 APN 10 60314694 missense probably damaging 1.00
IGL01461:Cdh23 APN 10 60409147 missense possibly damaging 0.53
IGL01469:Cdh23 APN 10 60597725 missense probably benign 0.03
IGL01695:Cdh23 APN 10 60331833 missense probably benign 0.20
IGL01734:Cdh23 APN 10 60303513 missense probably benign
IGL01767:Cdh23 APN 10 60315724 missense probably damaging 1.00
IGL01796:Cdh23 APN 10 60311137 missense probably benign 0.31
IGL01843:Cdh23 APN 10 60419819 splice site probably null
IGL02025:Cdh23 APN 10 60385143 missense probably damaging 1.00
IGL02071:Cdh23 APN 10 60523560 missense possibly damaging 0.93
IGL02160:Cdh23 APN 10 60597765 splice site probably benign
IGL02175:Cdh23 APN 10 60331308 missense possibly damaging 0.92
IGL02220:Cdh23 APN 10 60305124 missense probably damaging 1.00
IGL02302:Cdh23 APN 10 60323523 missense possibly damaging 0.87
IGL02331:Cdh23 APN 10 60465543 missense probably damaging 0.99
IGL02452:Cdh23 APN 10 60317942 missense probably damaging 0.99
IGL02499:Cdh23 APN 10 60385179 missense probably damaging 1.00
IGL02548:Cdh23 APN 10 60650122 missense probably benign 0.37
IGL02593:Cdh23 APN 10 60465995 splice site probably benign
IGL02626:Cdh23 APN 10 60391801 missense probably damaging 1.00
IGL02951:Cdh23 APN 10 60311364 missense probably damaging 1.00
IGL03145:Cdh23 APN 10 60376814 missense probably damaging 0.99
dee_dee UTSW 10 60308056 nonsense probably null
hersey UTSW 10 60308036 missense probably damaging 1.00
ANU22:Cdh23 UTSW 10 60312624 missense probably damaging 1.00
IGL02980:Cdh23 UTSW 10 60314620 missense probably damaging 1.00
PIT4362001:Cdh23 UTSW 10 60465458 missense probably benign 0.15
R0013:Cdh23 UTSW 10 60413173 missense possibly damaging 0.90
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0082:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R0124:Cdh23 UTSW 10 60308056 nonsense probably null
R0172:Cdh23 UTSW 10 60319632 missense probably damaging 1.00
R0195:Cdh23 UTSW 10 60317059 missense probably damaging 0.99
R0365:Cdh23 UTSW 10 60379315 missense probably damaging 0.99
R0437:Cdh23 UTSW 10 60410797 missense probably damaging 1.00
R0486:Cdh23 UTSW 10 60386946 missense probably damaging 1.00
R0494:Cdh23 UTSW 10 60316596 splice site probably benign
R0545:Cdh23 UTSW 10 60331291 missense probably benign 0.06
R0619:Cdh23 UTSW 10 60433777 missense probably damaging 1.00
R0647:Cdh23 UTSW 10 60307902 missense probably damaging 0.99
R0647:Cdh23 UTSW 10 60323374 nonsense probably null
R0730:Cdh23 UTSW 10 60323714 missense probably damaging 0.99
R0880:Cdh23 UTSW 10 60406421 missense possibly damaging 0.51
R0942:Cdh23 UTSW 10 60410860 missense possibly damaging 0.67
R0989:Cdh23 UTSW 10 60534510 missense probably damaging 0.99
R1017:Cdh23 UTSW 10 60331793 missense probably damaging 1.00
R1173:Cdh23 UTSW 10 60312392 splice site probably benign
R1449:Cdh23 UTSW 10 60376951 missense probably damaging 1.00
R1456:Cdh23 UTSW 10 60487120 missense possibly damaging 0.84
R1519:Cdh23 UTSW 10 60379343 missense possibly damaging 0.92
R1532:Cdh23 UTSW 10 60314331 missense probably damaging 0.99
R1559:Cdh23 UTSW 10 60419699 splice site probably benign
R1704:Cdh23 UTSW 10 60314611 missense probably damaging 1.00
R1711:Cdh23 UTSW 10 60523536 missense probably benign 0.07
R1760:Cdh23 UTSW 10 60326076 missense probably damaging 1.00
R1782:Cdh23 UTSW 10 60488542 missense probably damaging 1.00
R1791:Cdh23 UTSW 10 60391726 missense possibly damaging 0.89
R1803:Cdh23 UTSW 10 60331281 missense probably damaging 1.00
R1857:Cdh23 UTSW 10 60323297 missense probably damaging 1.00
R1874:Cdh23 UTSW 10 60436818 missense possibly damaging 0.52
R1914:Cdh23 UTSW 10 60323570 missense probably damaging 0.99
R1958:Cdh23 UTSW 10 60410873 missense probably benign 0.02
R1964:Cdh23 UTSW 10 60385222 missense probably benign 0.31
R1966:Cdh23 UTSW 10 60323582 missense probably damaging 1.00
R1981:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R2010:Cdh23 UTSW 10 60314227 missense probably damaging 0.99
R2036:Cdh23 UTSW 10 60466043 missense possibly damaging 0.52
R2038:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R2044:Cdh23 UTSW 10 60596730 missense possibly damaging 0.72
R2111:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2112:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2211:Cdh23 UTSW 10 60466004 missense possibly damaging 0.92
R2261:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2262:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2306:Cdh23 UTSW 10 60323445 missense probably damaging 1.00
R2344:Cdh23 UTSW 10 60316724 missense probably damaging 1.00
R2857:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2858:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2859:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2876:Cdh23 UTSW 10 60307496 missense probably damaging 1.00
R3034:Cdh23 UTSW 10 60409010 splice site probably benign
R3424:Cdh23 UTSW 10 60376881 missense possibly damaging 0.76
R3699:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3700:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3950:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3951:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3952:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R4108:Cdh23 UTSW 10 60410822 missense possibly damaging 0.51
R4114:Cdh23 UTSW 10 60421040 splice site probably null
R4273:Cdh23 UTSW 10 60311161 missense possibly damaging 0.69
R4284:Cdh23 UTSW 10 60303493 missense possibly damaging 0.91
R4334:Cdh23 UTSW 10 60385059 missense probably damaging 0.99
R4474:Cdh23 UTSW 10 60311086 missense probably damaging 1.00
R4532:Cdh23 UTSW 10 60534423 missense probably benign 0.32
R4597:Cdh23 UTSW 10 60409044 missense probably damaging 1.00
R4604:Cdh23 UTSW 10 60337666 missense possibly damaging 0.93
R4793:Cdh23 UTSW 10 60331350 missense probably damaging 1.00
R4816:Cdh23 UTSW 10 60409077 missense possibly damaging 0.93
R4833:Cdh23 UTSW 10 60385038 missense probably damaging 1.00
R4840:Cdh23 UTSW 10 60419777 missense possibly damaging 0.53
R4857:Cdh23 UTSW 10 60391784 missense probably damaging 1.00
R4869:Cdh23 UTSW 10 60376934 missense probably damaging 1.00
R4894:Cdh23 UTSW 10 60337851 missense probably benign 0.04
R4940:Cdh23 UTSW 10 60307935 missense probably damaging 0.98
R5020:Cdh23 UTSW 10 60308032 missense probably damaging 0.99
R5026:Cdh23 UTSW 10 60304848 missense possibly damaging 0.88
R5081:Cdh23 UTSW 10 60436807 missense possibly damaging 0.89
R5138:Cdh23 UTSW 10 60312282 missense probably damaging 1.00
R5236:Cdh23 UTSW 10 60312572 missense probably damaging 1.00
R5361:Cdh23 UTSW 10 60657265 critical splice donor site probably null
R5384:Cdh23 UTSW 10 60337762 missense probably damaging 0.99
R5500:Cdh23 UTSW 10 60314311 missense probably damaging 1.00
R5512:Cdh23 UTSW 10 60534386 splice site probably null
R5673:Cdh23 UTSW 10 60307857 missense probably damaging 1.00
R5720:Cdh23 UTSW 10 60393023 missense possibly damaging 0.71
R5726:Cdh23 UTSW 10 60407480 missense probably damaging 0.98
R5732:Cdh23 UTSW 10 60331317 missense possibly damaging 0.80
R5739:Cdh23 UTSW 10 60305609 missense probably damaging 0.99
R5760:Cdh23 UTSW 10 60406392 missense probably damaging 0.99
R5793:Cdh23 UTSW 10 60306128 missense probably damaging 1.00
R5880:Cdh23 UTSW 10 60384934 missense probably damaging 1.00
R5905:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R5907:Cdh23 UTSW 10 60428379 missense probably damaging 1.00
R5910:Cdh23 UTSW 10 60377821 missense possibly damaging 0.81
R5932:Cdh23 UTSW 10 60392984 missense probably damaging 1.00
R5996:Cdh23 UTSW 10 60413577 missense possibly damaging 0.85
R6015:Cdh23 UTSW 10 60307982 missense probably damaging 0.97
R6020:Cdh23 UTSW 10 60331326 missense probably damaging 1.00
R6023:Cdh23 UTSW 10 60465542 missense probably damaging 1.00
R6028:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R6066:Cdh23 UTSW 10 60433758 missense probably damaging 1.00
R6137:Cdh23 UTSW 10 60434512 missense probably damaging 0.96
R6211:Cdh23 UTSW 10 60410821 missense possibly damaging 0.90
R6298:Cdh23 UTSW 10 60426672 nonsense probably null
R6302:Cdh23 UTSW 10 60305093 missense possibly damaging 0.74
R6338:Cdh23 UTSW 10 60413151 missense probably damaging 1.00
R6356:Cdh23 UTSW 10 60438847 missense probably damaging 1.00
R6441:Cdh23 UTSW 10 60308036 missense probably damaging 1.00
R6714:Cdh23 UTSW 10 60331830 missense possibly damaging 0.62
R6760:Cdh23 UTSW 10 60306168 missense probably damaging 1.00
R6807:Cdh23 UTSW 10 60378871 missense possibly damaging 0.95
R6855:Cdh23 UTSW 10 60306122 missense possibly damaging 0.66
R6937:Cdh23 UTSW 10 60487114 missense probably damaging 1.00
R6942:Cdh23 UTSW 10 60438856 missense possibly damaging 0.93
R6961:Cdh23 UTSW 10 60650114 missense probably benign 0.00
R7010:Cdh23 UTSW 10 60530991 missense probably benign 0.03
R7032:Cdh23 UTSW 10 60331788 missense probably damaging 1.00
R7046:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R7111:Cdh23 UTSW 10 60387044 missense probably damaging 1.00
R7196:Cdh23 UTSW 10 60307980 missense probably damaging 0.99
R7198:Cdh23 UTSW 10 60312599 missense possibly damaging 0.91
R7223:Cdh23 UTSW 10 60331817 missense probably damaging 1.00
R7290:Cdh23 UTSW 10 60376841 missense probably benign
R7335:Cdh23 UTSW 10 60305116 missense probably damaging 1.00
R7340:Cdh23 UTSW 10 60530996 missense probably benign 0.19
R7350:Cdh23 UTSW 10 60410910 missense probably damaging 1.00
R7366:Cdh23 UTSW 10 60315692 nonsense probably null
R7374:Cdh23 UTSW 10 60317900 missense probably damaging 0.99
R7455:Cdh23 UTSW 10 60306224 missense possibly damaging 0.82
X0052:Cdh23 UTSW 10 60385134 missense probably damaging 1.00
Z1088:Cdh23 UTSW 10 60413644 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGCCTCCCAACAGGAATTTC -3'
(R):5'- AAGGAAATCTGGAGTGCCC -3'

Sequencing Primer
(F):5'- CCAACAGGAATTTCCCTTTTCC -3'
(R):5'- GGATAGGACCTATCTGCCTTCAG -3'
Posted On2019-05-13