Incidental Mutation 'R7010:Il17rc'
ID544959
Institutional Source Beutler Lab
Gene Symbol Il17rc
Ensembl Gene ENSMUSG00000030281
Gene Nameinterleukin 17 receptor C
Synonyms1110025H02Rik, IL17-RL, Il17rl
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location113471427-113483140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113479288 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 338 (N338S)
Ref Sequence ENSEMBL: ENSMUSP00000055343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032422] [ENSMUST00000058300]
Predicted Effect probably benign
Transcript: ENSMUST00000032422
SMART Domains Protein: ENSMUSP00000032422
Gene: ENSMUSG00000030284

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:DUF3456 45 103 1.7e-9 PFAM
EGF 154 193 2.11e1 SMART
FU 208 255 1.66e-1 SMART
EGF 213 244 2.2e1 SMART
EGF_like 245 290 4.26e-3 SMART
FU 268 315 4.46e-2 SMART
EGF_CA 305 344 1.1e-7 SMART
transmembrane domain 363 382 N/A INTRINSIC
transmembrane domain 387 406 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000058300
AA Change: N338S

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055343
Gene: ENSMUSG00000030281
AA Change: N338S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL17_R_N 71 190 2.8e-45 PFAM
Pfam:IL17_R_N 189 432 1.3e-93 PFAM
transmembrane domain 441 460 N/A INTRINSIC
Pfam:SEFIR 473 623 7.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204447
Predicted Effect probably benign
Transcript: ENSMUST00000204632
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I membrane protein that shares similarity with the interleukin-17 receptor (IL-17RA). Unlike IL-17RA, which is predominantly expressed in hemopoietic cells, and binds with high affinity to only IL-17A, this protein is expressed in nonhemopoietic tissues, and binds both IL-17A and IL-17F with similar affinities. The proinflammatory cytokines, IL-17A and IL-17F, have been implicated in the progression of inflammatory and autoimmune diseases. Multiple alternatively spliced transcript variants encoding different isoforms have been detected for this gene, and it has been proposed that soluble, secreted proteins lacking transmembrane and intracellular domains may function as extracellular antagonists to cytokine signaling. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit increased interleukin-17 secretion, reduced chemokine expression, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Il17rc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Il17rc APN 6 113474171 missense probably damaging 0.96
IGL03192:Il17rc APN 6 113472885 missense probably damaging 1.00
R1462:Il17rc UTSW 6 113478989 missense probably damaging 1.00
R1462:Il17rc UTSW 6 113478989 missense probably damaging 1.00
R4075:Il17rc UTSW 6 113481197 missense possibly damaging 0.82
R5025:Il17rc UTSW 6 113472366 missense possibly damaging 0.62
R5052:Il17rc UTSW 6 113472323 missense probably damaging 1.00
R5148:Il17rc UTSW 6 113482997 missense probably benign 0.19
R5302:Il17rc UTSW 6 113483036 missense possibly damaging 0.71
R5977:Il17rc UTSW 6 113482731 missense probably damaging 0.98
R6275:Il17rc UTSW 6 113480347 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTAACACTGTGCTGGCAG -3'
(R):5'- CGTTAACATGCGTCCTTAAAGCAC -3'

Sequencing Primer
(F):5'- GCAGGCACCAGACCAGAGTC -3'
(R):5'- AACAGTATCGTGCTGTAGCC -3'
Posted On2019-05-13